METODE PENELITIAN. Tempat dan Waktu. Bakteri Uji. Bahan dan Media

Ukuran: px
Mulai penontonan dengan halaman:

Download "METODE PENELITIAN. Tempat dan Waktu. Bakteri Uji. Bahan dan Media"

Transkripsi

1 39 METODE PENELITIAN Tempat dan Waktu Penelitian dilakukan di Laboratorium Patogen dan Bioteknologi Pangan (Southeast Asian Food and Agricultural Science and Technology) SEAFAST Center, Institut Pertanian Bogor. Penelitian berlangsung pada bulan Juni 2009 hingga Desember 2010 dan dilanjutkan pada bulan Juni 2010 hingga Juli Bakteri Uji Bakteri uji yang digunakan pada penelitian ini adalah sebanyak 14 isolat lokal S. aureus (AS, NU1, NU2, NU3, NU4, NU5, NU6, NU7, NU8, NU9, NU10, NU11, NU13 dan NU14) yang diisolasi dari ayam suwir dan nasi uduk sebagai salah satu produk pangan tradisional siap santap dan diperoleh dari daerah Babakan Raya, Bogor serta telah dilakukan uji biokimiawi oleh Apriyadi (2010). Isolat pembanding, yaitu S. aureus ATCC yang bersifat non-enterotoksigenik digunakan sebagai bakteri pembanding. Bahan dan Media Media-media yang digunakan untuk persiapan kultur bakteri S. aureus adalah TSB (Tryptone Soy Broth) (Becton and Dickinson, USA), TSA (Triptone Soy Agar) (CM 131 Oxoid Ltd., UK) dan BHI (Brain Heart Infussion) (Becton and Dickinson, USA). Beberapa bahan yang digunakan untuk isolasi DNA antara lain antara lain SDS (Sodium Dodecyl Sulphate) (Merck, Darmstadt, Germany), Tris (hydroxymethyl)-amino methan (Amerscham Bioscience, Sweden), NaCl (Natrium Chloride), sodium asetat, fenol (Sigma, USA), kloroform Merck, Darmstadt, Germany), isoamil alkohol (Merck, Darmstadt, Germany), etanol, lisozim (Bio Basic Inc), proteinase K (Fermentas), HCl (Merck, Darmstadt, Germany) dan akuabidestilata steril. Bahan-bahan yang digunakan untuk elektroforesis antara lain bufer TAE (Tris-asetat-EDTA), agarosa (GE Healthcare

2 40 Bio-Sciences AB), EtBr (Ethidium Bromide) (Amerscham Bioscience, Sweden), loading dye (Fermentas) serta Ladder DNA 100 bp dan 1 kb (Fermentas). Bahan-bahan yang digunakan untuk amplifikasi gen target, yaitu 16S rrna, gen penyandi enterotoksin stafilokoki A (SEA) dan enterotoksin stafilokoki C1 (SEC1) antara lain Green Dream Taq PCR MasterMix (Fermentas), water nuclease (Fermentas), cetakan DNA (DNA template) dan 3 pasang primer berturut-turut, yaitu 63f/1387r, SEA-1/SEA-2 dan SEC1-1/SEC1-2 (Tabel 10) (Marchesi et al., 1998; Johnson et al., 1991). Primer dipesan dari Alpha DNA (Notre-Dame St. W., Montreal, Quebec) (Johnson et al., 1991). Tabel 10 Pasangan primer oligonukleotida yang digunakan untuk amplifikasi gen target Kode Primer 63f 1387r SEA-1 SEA-2 SEC1-1 SEC1-2 Urutan Basa (5-3 ) CAG GCC TAA CAC ATG CAA GTC GGG CGG WGT GTA CAA GGC TTG GAA ACG GTT AAA ACG AA GAA CCT TCC CAT CAA AAA CA GAC ATA AAA GCT AGG AAT TT AAA TCG GAT TAA CAT TAT CC Gen Sumber Target 16S rrna Marchesi et al., (1998) SEA Johnson et al., (1991) SEC1 Johnson et al., (1991) Alat Alat-alat yang digunakan antara lain penangas air yang bertutup, termometer, inkubator 35 o C, mikroskop, jarum ose, tabung reaksi berulir, labu takar 50 ml, gelas ukur 50 ml, 100 ml dan 1000 ml; pipet mikro 2 ml, 20 ml, 100 ml dan 1000 ml; ph meter, vorteks, hot plate, alat sentrifus 18,000 rpm, pengaduk magnet, perangkat elektroforesis (Bio-Rad), perangkat PCR Applied Biosystem 2720 Thermal Cycler (Foster City, California), Geldoc XR (Bio-Rad), ABI Prism 3100-Avant Genetic Analyzer dengan 4-Capillary System (Applied Biosystem) dan spektrofotometer UV-Vis (Shimadzu). Beberapa software yang digunakan pada penelitian ini yaitu program BioEdit dan Program BLAST (Basic Local Alignment Search Tool) dari situs NCBI (www.ncbi. nlm.nih.gov) untuk menganalisis hasil sekuensing.

3 41 Pelaksanaan Penelitian Identifikasi secara morfologi dan biokimiawi terhadap 14 isolat lokal S. aureus diperoleh dari tahapan penelitian yang sudah dilakukan oleh Apriyadi (2010). Tahapan penelitian selanjutnya adalah melakukan identifikasi molekular yang meliputi: (a) isolasi DNA genom keempat belas isolat lokal S. aureus dan 1 isolat pembanding (S. aureus ATCC 25923) metode ekstraksi Doyle dan Doyle (1990) dengan beberapa modifikasi, (b) amplifikasi, visualisasi dan sekuensing gen 16S rrna untuk menentukan persen kemiripan antar isolat-isolat lokal S. aureus tersebut dengan menggunakan program BioEdit dan program BLAST dari situs NCBI (www.ncbi.nlm.nih.gov) dan (c) amplifikasi gen penyandi enterotoksin stafilokoki A (SEA) serta C1 (SEC1). Diagram alir pelaksanaan penelitian ditampilkan pada Gambar 3. Isolat S. aureus Persiapan kultur bakteri S. aureus dan pewarnaan Gram Spektrofotometri Isolasi DNA genom bakteri S. aureus dengan modifikasi dari metode ekstraksi Doyle dan Doyle (1989) Visualisasi Amplifikasi gen 16S rrna Sekuensing Amplifikasi gen SEA dan SEC1 Gambar 3 Diagram alir pelaksanaan penelitian

4 42 Persiapan dan Pewarnaan Gram Kultur Bakteri S. aureus Persiapan Kultur Bakteri Persiapan kultur dilakukan dengan cara bakteri S. aureus diinokulasikan ke dalam media TSA miring dan diinkubasi selama jam pada suhu 35 o C. Penyimpanan kultur dilakukan pada suhu 10 o C selama kurang lebih 2 minggu untuk kemudian dilakukan penyegaran kultur (BAM, 2001). Pewarnaan Gram Bakteri Kultur bakteri S. aureus pada media TSA miring diambil sebanyak satu ose ke dalam gelas objek, yang sebelumnya sudah digenangi akuades steril sebanyak dua ose dan setelah itu difiksasi. Selanjutnya ditambahkan kristal violet satu tetes selama 1 menit, dipastikan semua bagian lapisan digenangi larutan pewarna, lalu dibilas sempurna larutan kristal violet dengan air dan dikeringkan dengan kertas hisap, untuk kemudian ditambahkan iodium/lugol sebanyak satu tetes selama 1 menit. Larutan iodium/lugol dibilas kembali dengan akudes steril dan dikeringkan kembali, untuk selanjutnya ditambahkan alkohol 96% selama 5-15 detik hingga tidak ada lagi sisa pewarna violet yang mengalir. Selanjutnya ditambahkan larutan safranin satu tetes selama 1 menit, setelah itu dibilas dengan akuades steril dan dikeringkan, untuk kemudian diamati di bawah mikroskop (Harrigan, 1998). Identifikasi Molekuler Kultur Bakteri S. aureus Persiapan Kultur Bakteri Kultur bakteri dari media TSA miring diambil sebanyak satu ose ke dalam media BHI untuk kemudian diinkubasi selama semalam. Kultur bakteri S. aureus dari media BHI ini akan digunakan untuk melakukan isolasi DNA genom bakteri.

5 43 Isolasi DNA Genom Bakteri Isolasi DNA genom bakteri S. aureus dilakukan dengan metode Doyle dan Doyle (1990) yang telah dimodifikasi. Sel bakteri dari media BHI yang telah diinkubasi semalam dipanen melalui perlakuan sentrifugasi. Sebanyak 1.5 ml kultur bakteri dimasukkan ke dalam tabung Eppendorf 2.0 ml dan disentrifugasi pada 8,000 rpm selama 10 menit dengan suhu 4 o C. Pelet yang diperoleh diresuspensi dalam 1 ml NaCl 0.85% dan disentrifugasi pada 8,000 rpm selama 10 menit dengan suhu 4 o C. Pelet yang diperoleh kembali diresuspensi dalam 1 ml bufer TES dan disentrifugasi pada 8,000 rpm selama 10 menit dengan suhu 4 o C. Pelet yang diperoleh diresuspensi dalam 900 µl bufer TE, 100 µl SDS 10% dan 2 µl lisozim (2 mg/ml), untuk kemudian diinkubasi pada suhu 37 o C selama 1 jam. Selanjutnya, ditambahkan 2.5 µl proteinase-k (10 mg/ml) dan diinkubasi kembali pada suhu 65 o C selama 30 menit, dimana tiap 10 menit tabung dibolak-balik. Tahap selanjutnya ditambahkan 900 µl larutan phenol : chloroform : isoamilalcohol (PCI) (25:24:1), divorteks selama 3 menit dan disentrifugasi pada 8,000 rpm selama 10 menit dengan suhu 4 o C. Fase cairan (top layer) 400 µl dipindahkan ke tabung Eppendorf 2.0 ml yang baru, lalu ditambahkan 400 µl bufer TE, 40 µl SDS 10% dan larutan PCI (25:24:1) dengan volume yang sama (840 µl). Selanjutnya disentrifugasi pada 8,000 rpm selama 10 menit dengan suhu ruang (25 o C) untuk memisahkan fase campuran. Setelah itu, top layer dipindahkan kembali sebanyak 400 µl ke tabung Eppendorf 1.5 ml yang baru, lalu ditambahkan 0.1 volume sodium asetat 3 M ph 4.8 (40 µl) dan 2.0 volume etanol 100% (880 µl), kemudian dibolak-balik hingga tercampur merata. Tabung diinkubasi pada suhu -20 o C selama 1 jam, lalu DNA dipresipitasi dengan mensentrifugasi pada 13,500 rpm selama 10 menit dengan suhu 4 o C. Pelet ditambahkan 500 µl etanol 70% dan tabung dibolak-balikkan beberapa kali. Setelah itu disentrifugasi kembali pada 13,500 rpm selama 10 menit dengan suhu 4 o C. Pelet DNA dikeringkan dan diresuspensi dalam 40 µl akuabides steril. Untuk penyimpanan jangka panjang, larutan DNA disimpan pada suhu -20 o C. Verifikasi DNA dilakukan dengan elektroforesis menggunakan gel agarosa 1.5% dan 1x bufer TAE pada voltase 50 selama 45 menit. Gel kemudian diwarnai dengan

6 44 Ethidium Bromide (EtBr) dan divisualisasi pada panjang gelombang 302 nm (Geldoc XR, Bio-Rad). Uji kuantitas DNA genom hasil isolasi berupa kemurnian dan konsentrasi dilakukan dengan metode spektrofotometri pada panjang gelombang (λ) 260 nm dan 280 nm. Menurut Suharsono dan Widyastuti (2006), perhitungan kemurnian DNA diperoleh dari rasio nilai absorbansi (A) pada λ 260 nm dengan nilai absorbansi λ 280 nm atau seperti yang dirumuskan sebagai berikut: Kemurnian DNA = A λ 260 A λ 260 Perhitungan konsentrasi DNA diperoleh dari hasil perkalian antara nilai absorbansi pada panjang gelombang 260 nm dengan lima puluh dan faktor pengenceran seperti yang dirumuskan sebagai berikut: Konsentrasi DNA = A λ 260 x 50 x faktor pengenceran Amplifikasi Gen 16S rrna Bakteri Amplifikasi gen 16S rrna bakteri S. aureus dilakukan dengan menggunakan satu pasang primer, yaitu 63f dan 1387r (Marchesi et al, 1998). Protokol PCR yang digunakan adalah pre-pcr (95 o C, 3 menit), denaturasi (94 o C, 30 detik), penempelan primer (55 o C, 30 detik), elongasi atau pemanjangan primer (72 o C, 1 menit) dan post-pcr (72 o C, 5 menit) dengan siklus amplifikasi sebanyak 30 kali. Sebanyak 10 µl hasil PCR dielektroforesis pada gel agarosa 1.5% (w/v), dengan menggunakan 1x bufer TAE (Tris HCl- acetic acid-edta) pada voltase 50 selama 45 menit.

7 45 Sekuensing Gen 16S rrna Bakteri Fragmen DNA hasil PCR dimurnikan sebelum dilakukan sekuensing. Pemurnian produk PCR perlu dilakukan untuk mengurangi pengotor-pengotor berupa Mg 2+, DNA template dan dntp yang berlebih yang dapat mengganggu proses perunutan basa nukleotida sehingga dapat menimbulkan kesalahan dalam pembacaan hasil sekuensing (Applied Biosystem, 2002). Gen penyandi dari produk PCR yang telah diisolasi dan dimurnikan selanjutnya di-sekuensing dengan menggunakan ABI PRISM 3100-Avant Genetic Analyzer dengan 4-Capillary System (Applied Biosystem), dimana tahapan ini dilakukan di PT. Macrogen Inc., Seoul, Korea Selatan. Hasil sekuensing diolah dengan program BioEdit, kemudian dianalisis dengan menggunakan program BLAST dari NCBI (National Center of Biotechnology Information) pada situs (www.ncbi.nlm.nih.gov) untuk dibandingkan dengan data sekuen parsial gen 16S rrna dari beberapa galur S. aureus. Amplifikasi Gen Penyandi SEA dan SEC1 Untuk mengamplifikasi gen penyandi SEA digunakan primer SEA-1 dan SEA-2. Untuk SEC1 digunakan primer SEC1-1 dan SEC1-2 (Johnson et al., 1991). Protokol PCR yang digunakan untuk amplifikasi gen SEA adalah pre-pcr (95 o C, 3 menit), denaturasi (94 o C, 2 menit), penempelan primer (55 o C, 90 detik), elongasi atau pemanjangan primer (72 o C, 1 menit) dan post-pcr (72 o C, 5 menit) dengan siklus amplifikasi sebanyak 30 kali. Protokol PCR untuk amplifikasi gen SEC1 adalah pre-pcr (95 o C, 3 menit), denaturasi (94 o C, 30 detik), penempelan primer (54 o C, 30 detik), elongasi atau pemanjangan primer (72 o C, 1 menit) dan post-pcr (72 o C, 5 menit) dengan siklus amplifikasi sebanyak 30 kali. Hasil PCR sebanyak 10 µl dielektroforesis pada gel agarosa 1.5% (w/v), dengan menggunakan bufer 1x TAE pada voltase 70 selama 60 menit.

bio.unsoed.ac.id METODE PENELITIAN A. Materi, Lokasi, dan Waktu Penelitian 1. Materi Penelitian

bio.unsoed.ac.id METODE PENELITIAN A. Materi, Lokasi, dan Waktu Penelitian 1. Materi Penelitian III. METODE PENELITIAN A. Materi, Lokasi, dan Waktu Penelitian 1. Materi Penelitian 1.1. Peralatan Penelitian Alat yang digunakan dalam penelitian ini adalah botol sampel, beaker glass, cool box, labu

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN A. Jenis Penelitian Metode penelitian yang digunakan pada penelitian ini adalah deskriptif. Penelitian deskriptif bertujuan untuk membuat deskripsi, gambaran, atau lukisan secara

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN A. Jenis Penelitian deskriptif. Jenis penelitian yang digunakan adalah penelitian dasar dengan metode B. Objek Penelitian Objek penelitian ini adalah sampel DNA koleksi hasil

Lebih terperinci

BAB 4. METODE PENELITIAN

BAB 4. METODE PENELITIAN BAB 4. METODE PENELITIAN Penelitian penanda genetik spesifik dilakukan terhadap jenis-jenis ikan endemik sungai paparan banjir Riau yaitu dari Genus Kryptopterus dan Ompok. Penelitian ini bertujuan untuk

Lebih terperinci

BAHAN DAN METODE Waktu dan Tempat Bahan Metode Isolasi C. gloeosporioides dari Buah Avokad

BAHAN DAN METODE Waktu dan Tempat Bahan Metode Isolasi C. gloeosporioides dari Buah Avokad 15 BAHAN DAN METODE Waktu dan Tempat Penelitian dilaksanakan di Laboratorium Balai Besar Karantina Pertanian (BBKP) Tanjung Priok Wilayah Kerja Bogor, mulai bulan Oktober 2011 sampai Februari 2012. Bahan

Lebih terperinci

3. METODE PENELITIAN

3. METODE PENELITIAN 19 3. METODE PENELITIAN 3.1 Waktu dan Tempat Penelitian ini dilaksanakan pada bulan Maret sampai Juni 2010 di Laboratorium Mikrobiologi, Biokimia dan Bioteknologi Hasil Perairan Departemen Teknologi Hasil

Lebih terperinci

BAB III METODE PENELITIAN. Penelitian ini merupakan penelitian eksperimental dengan 7 sampel dari 7

BAB III METODE PENELITIAN. Penelitian ini merupakan penelitian eksperimental dengan 7 sampel dari 7 BAB III METODE PENELITIAN 3.1 Rancangan Penelitian Penelitian ini merupakan penelitian eksperimental dengan 7 sampel dari 7 individu udang Jari yang diambil dari Segara Anakan Kabupaten Cilacap Jawa Tengah.

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN 3.1 Waktu dan Tempat Penelitian ini dilaksanakan pada bulan Januari 2012 sampai bulan Juli 2012, yang bertempat di Laboratorium Genetika dan Biologi Molekuler Jurusan Biologi

Lebih terperinci

HASIL DAN PEMBAHASAN. Pewarnaan Gram

HASIL DAN PEMBAHASAN. Pewarnaan Gram 46 HASIL DAN PEMBAHASAN Pewarnaan Gram Hasil pewarnaan Gram menunjukkan bahwa 14 isolat lokal yang diduga sebagai S. aureus (AS, NU1, NU2, NU3, NU4, NU5, NU6, NU7, NU8, NU9, NU10, NU11, NU13 dan NU14)

Lebih terperinci

4.1. Alat dan Bahan Penelitian a. Alat Penelitian. No. URAIAN ALAT. A. Pengambilan sampel

4.1. Alat dan Bahan Penelitian a. Alat Penelitian. No. URAIAN ALAT. A. Pengambilan sampel 7 IV. METODE PENELITIAN Ikan Lais diperoleh dari hasil penangkapan ikan oleh nelayan dari sungaisungai di Propinsi Riau yaitu S. Kampar dan S. Indragiri. Identifikasi jenis sampel dilakukan dengan menggunakan

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN 3.1 Rancangan Penelitian Penelitian tentang Pengaruh Suhu Annealing pada Program PCR terhadap Keberhasilan Amplifikasi DNA Udang Jari (Metapenaeus elegans) Laguna Segara Anakan

Lebih terperinci

III. BAHAN DAN METODE

III. BAHAN DAN METODE III. BAHAN DAN METODE 3.1. Tempat dan Waktu Penelitian Penelitian dilakukan di Laboratorium Mikrobiologi, Balai Besar Penelitian dan Pengembangan Bioteknologi dan Sumberdaya Genetik Pertanian (BB. Biogen)

Lebih terperinci

MATERI DAN METODE. Kota Padang Sumatera Barat pada bulan Oktober Amplifikasi gen Growth

MATERI DAN METODE. Kota Padang Sumatera Barat pada bulan Oktober Amplifikasi gen Growth III. MATERI DAN METODE 3.1 Waktu dan Tempat Pengambilan sampel darah domba dilakukan di Kecamatan Koto Tengah Kota Padang Sumatera Barat pada bulan Oktober 2012. Amplifikasi gen Growth Hormone menggunakan

Lebih terperinci

BAB III METODE PENELITIAN. Penelitian ini merupakan penelitian yang dilakukan dengan metode

BAB III METODE PENELITIAN. Penelitian ini merupakan penelitian yang dilakukan dengan metode 16 BAB III METODE PENELITIAN A. Jenis Penelitian Penelitian ini merupakan penelitian yang dilakukan dengan metode deskriptif. Penelitian deskriptif adalah suatu metode penelitian untuk membuat deskripsi,

Lebih terperinci

3 METODE PENELITIAN. Lokasi Penelitian dan Waktu Penelitian

3 METODE PENELITIAN. Lokasi Penelitian dan Waktu Penelitian 10 3 METODE PENELITIAN Lokasi Penelitian dan Waktu Penelitian Penelitian ini dilakukan di Laboratorium SEAFAST (South East Asia Food and Agricultural Science and Technology) Center, kampus IPB Darmaga,

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN 25 BAB III METODE PENELITIAN 3.1 Waktu dan Tempat Penelitian telah berlangsung sejak bulan Januari 2012 - Juli 2012 di Laboratorium Mikrobiologi, Lab. Optik, Lab. Genetika dan Lab. Biologi Molekuler Jurusan

Lebih terperinci

BAB III. METODOLOGI PENELITIAN. Pengambilan sampel. Penyiapan templat mtdna dengan metode lisis sel

BAB III. METODOLOGI PENELITIAN. Pengambilan sampel. Penyiapan templat mtdna dengan metode lisis sel 16 BAB III. METODOLOGI PENELITIAN Bab ini menggambarkan tahapan penelitian yang terdiri dari pengambilan sampel, penyiapan templat mtdna dengan metode lisis sel, amplifikasi D-loop mtdna dengan teknik

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN 39 BAB III METODE PENELITIAN A. Desain Penelitian Penelitian yang dilakukan merupakan penelitian deskriptif. Penelitian membuat deskripsi secara sistematis, faktual dan akurat mengenai fakta-fakta dan

Lebih terperinci

3 METODOLOGI 3.1 Waktu dan Tempat 3.2 Bahan dan Alat

3 METODOLOGI 3.1 Waktu dan Tempat 3.2 Bahan dan Alat 3 METODOLOGI 3.1 Waktu dan Tempat Penelitian Autentikasi Bahan Baku Ikan Tuna (Thunnus sp.) dalam Rangka Peningkatan Keamanan Pangan dengan Metode Berbasis DNA dilaksanakan pada bulan Januari sampai dengan

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN A. Jenis Penelitian Penelitian ini merupakan penelitian murni yang dilakukan dengan metode deskriptif, yaitu suatu metode penelitian untuk membuat deskripsi, gambaran atau lukisan

Lebih terperinci

BAB III METODE PENELITIAN. amplifikasi daerah HVI mtdna sampel dengan menggunakan teknik PCR;

BAB III METODE PENELITIAN. amplifikasi daerah HVI mtdna sampel dengan menggunakan teknik PCR; BAB III METODE PENELITIAN Secara garis besar, langkah-langkah yang dilakukan dalam penelitian ini adalah: pengumpulan sampel; lisis terhadap sampel mtdna yang telah diperoleh; amplifikasi daerah HVI mtdna

Lebih terperinci

MATERI DAN METODE. Materi

MATERI DAN METODE. Materi MATERI DAN METODE Lokasi dan Waktu Penelitian dilaksanakan di Laboratorium Genetika Molekuler Ternak, Departemen Ilmu Produksi dan Teknologi Peternakan, Fakultas Peternakan IPB dan Laboratorium Terpadu,

Lebih terperinci

LAMPIRAN. Lampiran 1. Deskripsi Pembuatan Larutan Stok dan Buffer

LAMPIRAN. Lampiran 1. Deskripsi Pembuatan Larutan Stok dan Buffer LAMPIRAN Lampiran 1. Deskripsi Pembuatan Larutan Stok dan Buffer 1. Pembuatan Larutan Stok a. CTAB 5 % Larutan dibuat dengan melarutkan : - NaCl : 2.0 gr - CTAB : 5.0 gr - Aquades : 100 ml b. Tris HCl

Lebih terperinci

VISUALISASI HASIL PCR DENGAN METODE PCR LANGSUNG DAN TIDAK LANGSUNG PADA SAMPEL BAKTERI Pseudomonas fluorescens dan Ralstonia solanacearum

VISUALISASI HASIL PCR DENGAN METODE PCR LANGSUNG DAN TIDAK LANGSUNG PADA SAMPEL BAKTERI Pseudomonas fluorescens dan Ralstonia solanacearum VISUALISASI HASIL PCR DENGAN METODE PCR LANGSUNG DAN TIDAK LANGSUNG PADA SAMPEL BAKTERI Pseudomonas fluorescens dan Ralstonia solanacearum Pendahuluan Polymerase Chain Reaction (PCR) adalah suatu teknik

Lebih terperinci

LAPORAN II (ISOLASI DNA GENOM)

LAPORAN II (ISOLASI DNA GENOM) LAPORAN PRAKTIKUM REKAYASA GENETIKA LAPORAN II (ISOLASI DNA GENOM) KHAIRUL ANAM P051090031/BTK BIOTEKNOLOGI SEKOLAH PASCASARJANA INSTITUT PERTANIAN BOGOR 2010 0 ISOLASI DNA GENOM TUJUAN 16s rrna. Praktikum

Lebih terperinci

BAB III METODE PENELITIAN. Dalam penelitian ini dilakukan lima tahap utama yang meliputi tahap

BAB III METODE PENELITIAN. Dalam penelitian ini dilakukan lima tahap utama yang meliputi tahap BAB III METODE PENELITIAN Dalam penelitian ini dilakukan lima tahap utama yang meliputi tahap penyiapan templat mtdna, amplifikasi fragmen mtdna pada daerah D-loop mtdna manusia dengan teknik PCR, deteksi

Lebih terperinci

BAB III METODE PENELITIAN Bagan Alir Penelitian ini secara umum dapat digambarkan pada skema berikut:

BAB III METODE PENELITIAN Bagan Alir Penelitian ini secara umum dapat digambarkan pada skema berikut: BAB III METODE PENELITIAN Tahapan-tahapan yang dilakukan dalam penelitian ini adalah: pengumpulan sampel, lisis terhadap sampel mtdna yang telah diperoleh, amplifikasi daerah HVI mtdna sampel dengan menggunakan

Lebih terperinci

BAB III METODE PENELITIAN. Secara garis besar langkah-langkah yang dilakukan dalam penelitian ini

BAB III METODE PENELITIAN. Secara garis besar langkah-langkah yang dilakukan dalam penelitian ini BAB III METODE PENELITIAN Secara garis besar langkah-langkah yang dilakukan dalam penelitian ini adalah: pengumpulan sampel; lisis terhadap sampel mtdna yang telah diperoleh; amplifikasi daerah D-loop

Lebih terperinci

MATERI DAN METODE. Materi. Tabel 1. Sampel Darah Sapi Perah dan Sapi Pedaging yang Digunakan No. Bangsa Sapi Jenis Kelamin

MATERI DAN METODE. Materi. Tabel 1. Sampel Darah Sapi Perah dan Sapi Pedaging yang Digunakan No. Bangsa Sapi Jenis Kelamin MATERI DAN METODE Lokasi dan Waktu Penelitian ini dilaksanakan di Laboratorium Genetika Molekuler Ternak, Bagian Pemuliaan dan Genetika, Fakultas Peternakan, Institut Pertanian Bogor. Penelitian ini berlangsung

Lebih terperinci

III. METODOLOGI PENELITIAN

III. METODOLOGI PENELITIAN III. METODOLOGI PENELITIAN A. BAHAN DAN ALAT 1. Bahan Bahan-bahan yang digunakan dalam penelitian ini antara lain media penyegaran mikroba, media pertumbuhan, media pemupukan mikroba, pengencer, medium

Lebih terperinci

BAB 3 METODOLOGI PENELITIAN

BAB 3 METODOLOGI PENELITIAN BAB 3 METODOLOGI PENELITIAN 3.1 Desain Penelitian Bentuk desain penelitian yang akan digunakan adalah bentuk deskriptif molekuler potong lintang untuk mengetahui dan membandingkan kekerapan mikrodelesi

Lebih terperinci

II. METODE PENELITIAN

II. METODE PENELITIAN II. METODE PENELITIAN 1. Materi, Lokasi, dan Waktu Penelitian 1.1. Materi Alat yang digunakan dalam penelitian ini adalah botol sampel, cawan petri, tabung reaksi, labu Erlenmeyer, beaker glass, object

Lebih terperinci

METODE Waktu dan Tempat Materi Sampel DNA Primer

METODE Waktu dan Tempat Materi Sampel DNA Primer METODE Waktu dan Tempat Penelitian ini dilaksanakan mulai bulan September 2010 sampai dengan bulan Pebruari 2011. Penelitian dilakukan di Laboratorium Genetika Molekuler Ternak Bagian Pemuliaan dan Genetika

Lebih terperinci

Asam Asetat Glacial = 5,7 ml EDTA 0,5 M ph 8.0 = 10 ml Aquades ditambahkan hingga volume larutan 100 ml

Asam Asetat Glacial = 5,7 ml EDTA 0,5 M ph 8.0 = 10 ml Aquades ditambahkan hingga volume larutan 100 ml 36 Lampiran 1. Pembuatan Larutan Stok dan Buffer A. Pembuatan Larutan Stok Tris HCL 1 M ph 8.0 (100 ml) : Timbang Tris sebanyak 12,114 g. Masukkan Tris ke dalam Erlenmeyer dan ditambahkan 80 ml aquades.

Lebih terperinci

Pengambilan sampel tanah dari lahan tambang timah di Belitung. Isolasi bakteri pengoksidasi besi dan sulfur. Pemurnian isolat bakteri

Pengambilan sampel tanah dari lahan tambang timah di Belitung. Isolasi bakteri pengoksidasi besi dan sulfur. Pemurnian isolat bakteri Lampiran 1. Skema Kerja Penelitian Pengambilan sampel tanah dari lahan tambang timah di Belitung Isolasi bakteri pengoksidasi besi dan sulfur Pemurnian isolat bakteri Karakteriasi isolat bakteri pengoksidasi

Lebih terperinci

III. METODELOGI PENELITIAN. Penelitian ini telah dilaksanakan pada bulan November 2013 sampai dengan

III. METODELOGI PENELITIAN. Penelitian ini telah dilaksanakan pada bulan November 2013 sampai dengan III. METODELOGI PENELITIAN 3.1 Waktu dan Tempat Penelitian Penelitian ini telah dilaksanakan pada bulan November 2013 sampai dengan Maret 2014 di Laboratorium Penyakit Budidaya Perairan Fakultas Pertanian

Lebih terperinci

Bab III Bahan dan Metode III.1 Bahan III. 2 Alat

Bab III Bahan dan Metode III.1 Bahan III. 2 Alat Bab III Bahan dan Metode III.1 Bahan Pada penelitian ini, sampel yang digunakan dalam penelitian, adalah cacing tanah spesies L. rubellus yang berasal dari peternakan cacing tanah lokal di Sekeloa, Bandung.

Lebih terperinci

BAB III METODOLOGI PENELITIAN. Pada penelitian ini terdapat lima tahapan penelitian yang dilakukan yaitu

BAB III METODOLOGI PENELITIAN. Pada penelitian ini terdapat lima tahapan penelitian yang dilakukan yaitu BAB III METODOLOGI PENELITIAN Pada penelitian ini terdapat lima tahapan penelitian yang dilakukan yaitu pengumpulan sampel berupa akar rambut, ekstraksi mtdna melalui proses lisis akar rambut, amplifikasi

Lebih terperinci

BAB III METODE PENELITIAN. Penelitian ini merupakan jenis penelitian dasar dengan menggunakan

BAB III METODE PENELITIAN. Penelitian ini merupakan jenis penelitian dasar dengan menggunakan 21 BAB III METODE PENELITIAN A. Jenis Penelitian Penelitian ini merupakan jenis penelitian dasar dengan menggunakan metode deskriptif. B. Populasi dan sampel 1. Populasi yang digunakan dalam penelitian

Lebih terperinci

II. BAHAN DAN METODE. Betina BEST BB NB RB. Nirwana BN NN RN. Red NIFI BR NR RR

II. BAHAN DAN METODE. Betina BEST BB NB RB. Nirwana BN NN RN. Red NIFI BR NR RR II. BAHAN DAN METODE Ikan Uji Ikan uji yang digunakan adalah ikan nila hibrida hasil persilangan resiprok 3 strain BEST, Nirwana dan Red NIFI koleksi Balai Riset Perikanan Budidaya Air Tawar Sempur, Bogor.

Lebih terperinci

BAB III METODOLOGI PENELITIAN. Jenis penelitian yang digunakan adalah penelitian dasar dengan metode

BAB III METODOLOGI PENELITIAN. Jenis penelitian yang digunakan adalah penelitian dasar dengan metode 24 BAB III METODOLOGI PENELITIAN A. Jenis Penelitian Jenis penelitian yang digunakan adalah penelitian dasar dengan metode penelitian deskriptif. B. Objek Penelitian Empat spesies burung anggota Famili

Lebih terperinci

MATERI DAN METODE. Lokasi dan Waktu. Materi. Tabel 1. Jumah Sampel Darah Ternak Sapi Indonesia Ternak n Asal Sapi Bali 2 4

MATERI DAN METODE. Lokasi dan Waktu. Materi. Tabel 1. Jumah Sampel Darah Ternak Sapi Indonesia Ternak n Asal Sapi Bali 2 4 MATERI DAN METODE Lokasi dan Waktu Penelitian dilaksanakan di Laboratorium Genetika Molekuler Ternak, Bagian Pemuliaan dan Genetika Ternak, Fakultas Peternakan, Institut Pertanian Bogor. penelitian ini

Lebih terperinci

Penelitian ini dilakukan di laboratorium Mikrobiologi Pangan Universitas Katolik Soegijapranata pada Agustus 2013 hingga Januari 2014.

Penelitian ini dilakukan di laboratorium Mikrobiologi Pangan Universitas Katolik Soegijapranata pada Agustus 2013 hingga Januari 2014. 2. MATERI DAN METODE 2.1. Waktu dan Tempat Penelitian Penelitian ini dilakukan di laboratorium Mikrobiologi Pangan Universitas Katolik Soegijapranata pada Agustus 2013 hingga Januari 2014. 2.2. Materi

Lebih terperinci

4. HASIL DAN PEMBAHASAN

4. HASIL DAN PEMBAHASAN 29 4. HASIL DAN PEMBAHASAN 4.1 Karakteristik isolat bakteri dari ikan tuna dan cakalang 4.1.1 Morfologi isolat bakteri Secara alamiah, mikroba terdapat dalam bentuk campuran dari berbagai jenis. Untuk

Lebih terperinci

Gambar Penerapan metode..., Anglia Puspaningrum, FMIPA UI, 2008

Gambar Penerapan metode..., Anglia Puspaningrum, FMIPA UI, 2008 Gambar 52 Gambar 1. Hasil elektroforesis Escherichia coli ATCC 25922 yang diisolasi menggunakan CTAB dan diamplifikasi dengan PCR [lajur 1 dan lajur 2]. 650 pb 500 pb Gambar 2. Hasil elektroforesis sampel

Lebih terperinci

BAB III METODOLOGI PENELITIAN. Penelitian akan diawali dengan preparasi alat dan bahan untuk sampling

BAB III METODOLOGI PENELITIAN. Penelitian akan diawali dengan preparasi alat dan bahan untuk sampling 16 BAB III METODOLOGI PENELITIAN Penelitian akan diawali dengan preparasi alat dan bahan untuk sampling sel folikel akar rambut. Sampel kemudian dilisis, diamplifikasi dan disekuensing dengan metode dideoksi

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN 3.1 Rancangan Penelitian Penelitian tentang Karakterisasi genetik Udang Jari (Metapenaeus elegans De Man, 1907) hasil tangkapan dari Laguna Segara Anakan berdasarkan haplotipe

Lebih terperinci

FAKULTAS BIOLOGI LABORATORIUM GENETIKA & PEMULIAAN INSTRUKSI KERJA UJI

FAKULTAS BIOLOGI LABORATORIUM GENETIKA & PEMULIAAN INSTRUKSI KERJA UJI ISOLASI TOTAL DNA TUMBUHAN DENGAN KIT EKSTRAKSI DNA PHYTOPURE Halaman : 1 dari 5 1. RUANG LINGKUP Metode ini digunakan untuk mengisolasi DNA dari sampel jaringan tumbuhan, dapat dari daun, akar, batang,

Lebih terperinci

BAB III METODE A. Jenis Penelitian B. Populasi dan Sampel C. Waktu dan Lokasi Penelitian D. Alat dan Bahan Rizki Indah Permata Sari,2014

BAB III METODE A. Jenis Penelitian B. Populasi dan Sampel C. Waktu dan Lokasi Penelitian D. Alat dan Bahan Rizki Indah Permata Sari,2014 34 BAB III METODE A. Jenis Penelitian Penelitian ini merupakan penelitian murni atau pure research yang dilakukan dengan metode deskriptif, yaitu suatu metode penelitian untuk membuat deskripsi, gambaran

Lebih terperinci

LAMPIRAN. Lampiran 1. Pembuatan Larutan Stok dan Buffer

LAMPIRAN. Lampiran 1. Pembuatan Larutan Stok dan Buffer LAMPIRAN Lampiran 1. Pembuatan Larutan Stok dan Buffer A. LARUTAN STOK CTAB 5 % (100 ml) - Ditimbang NaCl sebanyak 2.0 gram - Ditimbang CTAB sebanyak 5.0 gram. - Dimasukkan bahan kimia ke dalam erlenmeyer

Lebih terperinci

III. MATERI DAN METODE. Fakultas Pertanian dan Peternakan Universitas Islam Negeri Sultan Syarif Kasim

III. MATERI DAN METODE. Fakultas Pertanian dan Peternakan Universitas Islam Negeri Sultan Syarif Kasim III. MATERI DAN METODE 3.1 Waktu dan Tempat Penelitian ini akan dilaksanakan di Laboratorium Genetika dan Pemuliaan Fakultas Pertanian dan Peternakan Universitas Islam Negeri Sultan Syarif Kasim Riau Pekanbaru

Lebih terperinci

Air Panas. Isolat Murni Bakteri. Isolat Bakteri Selulolitik. Isolat Terpilih Bakteri Selulolitik. Kuantitatif

Air Panas. Isolat Murni Bakteri. Isolat Bakteri Selulolitik. Isolat Terpilih Bakteri Selulolitik. Kuantitatif 75 Lampiran 1. Metode Kerja L.1.1 Bagan kerja Air Panas - Isolasi dan Seleksi Bakteri Pemurnian Bakteri Isolat Murni Bakteri Uji Bakteri Penghasil Selulase Secara Kualitatif Isolat Bakteri Selulolitik

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN 3.1 Tempat dan Waktu Penelitian Kegiatan penelitan ini meliputi kegiatan kultivasi kandidat bakteri probiotik dari saluran pencernaan ikan sidat (Anguilla bicolor), uji aktivitas

Lebih terperinci

II. METODELOGI PENELITIAN

II. METODELOGI PENELITIAN II. METODELOGI PENELITIAN 2.1 Metode Pengumpulan Data 2.1.1 Waktu dan Tempat Penelitian Penelitian ini dilakukan di UPT Laboratorium Biosain dan Bioteknologi Universitas Udayana. Penelitian ini berlangsung

Lebih terperinci

3 Metodologi Penelitian

3 Metodologi Penelitian 3 Metodologi Penelitian 3.1 Alat Penelitian ini dilakukan di Laboratorium Penelitian Biokimia, Program Studi Kimia, Institut Teknologi Bandung. Peralatan yang digunakan pada penelitian ini diantaranya

Lebih terperinci

FAKULTAS BIOLOGI LABORATORIUM GENETIKA & PEMULIAAN INSTRUKSI KERJA UJI

FAKULTAS BIOLOGI LABORATORIUM GENETIKA & PEMULIAAN INSTRUKSI KERJA UJI Halaman : 1 dari 5 ISOLASI TOTAL DNA HEWAN DENGAN KIT EKSTRAKSI DNA 1. RUANG LINGKUP Metode ini digunakan untuk mengisolasi DNA dari sampel jaringan hewan, dapat dari insang, otot, darah atau jaringan

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN A. Jenis Penelitian Jenis penelitian ini adalah penelitian deskriptif yang mengangkat fenomena alam sebagai salah satu masalah dalam penelitian. Penelitian ini dapat menerangkan

Lebih terperinci

3 Metode Penelitian. 3.1 Alat

3 Metode Penelitian. 3.1 Alat 3 Metode Penelitian 3.1 Alat Peralatan yang digunakan pada penelitian ini adalah peralatan gelas standar meliputi: labu erlenmeyer, cawan petri, gelas ukur, gelas kimia, botol reagen, tabung reaksi, batang

Lebih terperinci

METODOLOGI PENELITIAN

METODOLOGI PENELITIAN II. METODOLOGI PENELITIAN A. Tempat dan Waktu Penelitian Penelitian ini dilaksanakan di Pusat Riset Obat dan Makanan Badan POM RI pada bulan April 2011 hingga Juli 2011. B. Bahan Bahan-bahan yang digunakan

Lebih terperinci

BAB III METODE PENELITIAN. Jenis penelitian yang dilakukan termasuk dalam penelitian dasar yang. dilakukan dengan metode deskriptif (Nazir, 1998).

BAB III METODE PENELITIAN. Jenis penelitian yang dilakukan termasuk dalam penelitian dasar yang. dilakukan dengan metode deskriptif (Nazir, 1998). BAB III METODE PENELITIAN A. Jenis Penelitian Jenis penelitian yang dilakukan termasuk dalam penelitian dasar yang dilakukan dengan metode deskriptif (Nazir, 1998). B. Populasi dan Sampel 1. Populasi yang

Lebih terperinci

Metodologi Penelitian. Metode, bahan dan alat yang digunakan dalam penelitian ini akan dipaparkan pada bab ini.

Metodologi Penelitian. Metode, bahan dan alat yang digunakan dalam penelitian ini akan dipaparkan pada bab ini. Bab III Metodologi Penelitian Metode, bahan dan alat yang digunakan dalam penelitian ini akan dipaparkan pada bab ini. III.1 Rancangan Penelitian Secara garis besar tahapan penelitian dijelaskan pada diagram

Lebih terperinci

Pembuatan Media Kultur Bakteri Pemanenan sel bakteri. Isolasi DNA kromosom bakteri. Kloning DNA

Pembuatan Media Kultur Bakteri Pemanenan sel bakteri. Isolasi DNA kromosom bakteri. Kloning DNA LAMPIRAN 15 15 Lampiran 1 Tahapan penelitian Pembuatan Media Kultur Bakteri Pemanenan sel bakteri Isolasi DNA kromosom bakteri Pemotongan DNA dengan enzim restriksi Kloning DNA Isolasi DNA plasmid hasil

Lebih terperinci

BAHAN DAN METODE Tempat dan Waktu Penelitian Bahan dan Alat

BAHAN DAN METODE Tempat dan Waktu Penelitian Bahan dan Alat 12 BAHAN DAN METODE Tempat dan Waktu Penelitian Survei penyakit klorosis dan koleksi sampel tanaman tomat sakit dilakukan di sentra produksi tomat di daerah Cianjur, Cipanas, Lembang, dan Garut. Deteksi

Lebih terperinci

BAB III BAHAN DAN METODE

BAB III BAHAN DAN METODE 9 BAB III BAHAN DAN METODE 3.1 Waktu dan Tempat Penelitian Penelitian dilaksanakan pada bulan September 2011 sampai dengan Juli 2012. Kegiatan ekstraksi DNA sampai PCR-RFLP dilakukan di laboratorium Analisis

Lebih terperinci

METODOLOGI. Waktu dan Tempat Penelitian. Bahan dan Alat. Cara Kerja

METODOLOGI. Waktu dan Tempat Penelitian. Bahan dan Alat. Cara Kerja 17 METODOLOGI Waktu dan Tempat Penelitian Penelitian dilakukan dari bulan Agustus 2011 sampai Maret 2012 di Laboratorium Biokatalis dan Fermentasi pada Pusat Penelitian Bioteknologi Lembaga Ilmu Pengetahuan

Lebih terperinci

BAB III METODE PENELITIAN. Penelitian ini merupakan jenis penelitian dasar dengan menggunakan

BAB III METODE PENELITIAN. Penelitian ini merupakan jenis penelitian dasar dengan menggunakan BAB III METODE PENELITIAN A. Jenis Penelitian Penelitian ini merupakan jenis penelitian dasar dengan menggunakan metode deskriptif. B. Populasi dan Sampel 1. Populasi yang digunakan dalam penelitian adalah

Lebih terperinci

III. METODE PENELITIAN. Penelitian ini dilakukan di Laboratorium Mikrobiologi Jurusan Biologi

III. METODE PENELITIAN. Penelitian ini dilakukan di Laboratorium Mikrobiologi Jurusan Biologi 13 III. METODE PENELITIAN A. Tempat dan Waktu Penelitian Penelitian ini dilakukan di Laboratorium Mikrobiologi Jurusan Biologi Fakultas Matematika dan Ilmu Pengetahuan Alam Universitas Lampung. Penelitian

Lebih terperinci

BAB III BAHAN DAN METODE PENELITIAN

BAB III BAHAN DAN METODE PENELITIAN BAB III BAHAN DAN METODE PENELITIAN 3.1 Waktu dan Lokasi Penelitian 3.1.1. Lokasi Penelitian Penelitian ini dilakukan di Laboratorium Bioteknologi Perikanan dan Kelautan Fakultas Perikanan dan Ilmu Kelautan

Lebih terperinci

BAB 3 PERCOBAAN Mikroba C. violaceum, Bacillus cereus dan E. coli JM 109

BAB 3 PERCOBAAN Mikroba C. violaceum, Bacillus cereus dan E. coli JM 109 9 BAB 3 PERCOBAAN 3.1 Alat, Bahan dan Miroba 3.1.1 Alat Bunsen, inkubator 37 o C, sentrifuga (Mikro 200R Hettich), Eppendorf 100 ul, 500 ul, 1,5 ml, tabung mikrosentrifuga (Eppendorf), neraca timbang (Mettler

Lebih terperinci

TATA CARA PENELITIAN. Tempat dan Waktu Penelitian. Laboratorium Biologi Molekuler, Balai Besar Penelitian dan Pengembangan

TATA CARA PENELITIAN. Tempat dan Waktu Penelitian. Laboratorium Biologi Molekuler, Balai Besar Penelitian dan Pengembangan III. TATA CARA PENELITIAN A. Tempat dan Waktu Penelitian Penelitian ini dilaksanakan pada bulan Juli hingga Agustus 2017 di Laboratorium Biologi Molekuler, Balai Besar Penelitian dan Pengembangan Bioteknologi

Lebih terperinci

BAB 3 PERCOBAAN 3.1 Bahan 3.2 Alat

BAB 3 PERCOBAAN 3.1 Bahan 3.2 Alat BAB 3 PERCOBAAN 3.1 Bahan Bahan yang digunakan memiliki kualitas pro analisis atau pro biologi molekular, yaitu : primer M. tuberculosis forward: 5 GGATCCGATGAGCAAGCTGATCGAA3 (Proligo) dan primer M. tuberculosis

Lebih terperinci

HASIL DAN PEMBAHASAN

HASIL DAN PEMBAHASAN HASIL DAN PEMBAHASAN Amplifikasi ini membutuhkan primer spesifik (sekuen oligonukelotida khusus) untuk daerah tersebut. Primer biasanya terdiri dari 10-20 nukleotida dan dirancang berdasarkan daerah konservatif

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN A. Jenis Penelitian Jenis penelitian yang dilakukan adalah penelitian deskriptif. Penelitian deskriptif adalah penelitian yang mendeskripsikan suatu gambaran yang sistematis dengan

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN A. Jenis penelitian Jenis penelitian ini adalah penelitian deskriptif yang mengangkat fenomena alam sebagai salah satu masalah dalam penelitian, sehingga dapat menerangkan arti

Lebih terperinci

BAB III BAHAN DAN METODE

BAB III BAHAN DAN METODE BAB III BAHAN DAN METODE 3.1. Tempat dan Waktu Penelitian 3.1.1. Tempat Penelitian Penelitian dilaksanakan di Laboratorium Bioteknologi Perikanan dan Kelautan Fakultas Perikanan dan Ilmu Kelautan Universitas

Lebih terperinci

III. Bahan dan Metode

III. Bahan dan Metode III. Bahan dan Metode A. Bahan Sampel yang digunakan adalah bakteri penghasil biopigmen hasil isolasi dari Acropora nasuta yang diambil dari Taka Cemara Karimunjawa, Jepara, Jawa Tengah. Bahan kimia yang

Lebih terperinci

MATERI DAN METODE Lokasi dan Waktu Materi Sampel Pengambilan Sampel Ekstraksi DNA Primer

MATERI DAN METODE Lokasi dan Waktu Materi Sampel Pengambilan Sampel Ekstraksi DNA Primer MATERI DAN METODE Lokasi dan Waktu Penelitian ini dilaksanakan pada bulan Juni hingga Nopember 2010. Penelitian dilakukan di Laboratorium Pemuliaan dan Genetik Molekuler, Bagian Pemuliaan dan Genetik Ternak,

Lebih terperinci

MATERI DAN METODE. Lokasi dan Waktu

MATERI DAN METODE. Lokasi dan Waktu MATERI DAN METODE Lokasi dan Waktu Analisis Polymerase Chain Reaction (PCR) serta analisis penciri Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) dilaksanakan di Laboratorium

Lebih terperinci

BAHAN DAN METODE Tempat dan Waktu Penyediaan Isolat dan Karakterisasi Bakteri Xanthomonas campestris

BAHAN DAN METODE Tempat dan Waktu Penyediaan Isolat dan Karakterisasi Bakteri Xanthomonas campestris 12 BAHAN DAN METODE Tempat dan Waktu Penelitian dilaksanakan mulai Nopember 2011 sampai dengan Maret 2012 di Laboratorium Bakteriologi Tumbuhan dan Laboratorium Fisiologi dan Toksikologi Serangga Departemen

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN A. Jenis Penelitian Jenis penelitian yang digunakan adalah penelitian dasar dengan metode deskriptif (Nazir, 1983). B. Populasi dan Sampel Populasi dalam penelitian ini adalah

Lebih terperinci

Tujuan Penelitian. Manfaat Penelitian

Tujuan Penelitian. Manfaat Penelitian 2 mikroorganisme patogen pada bahan pangan dan juga memiliki kemampuan probiotik untuk kesehatan konsumen. Berdasarkan latar belakang tersebut, maka perlu dilakukan seleksi yaitu mencari beberapa isolat

Lebih terperinci

MATERI DAN METODE. Materi

MATERI DAN METODE. Materi MATERI DAN METODE Lokasi dan Waktu Penelitian ini dilaksanakan di Laboratorium Genetika dan Molekuler Ternak, Departemen Ilmu Produksi dan Teknologi Peternakan, Fakultas Peternakan, Institut Pertanian

Lebih terperinci

II. MATERI DAN METODE. Tempat pengambilan sampel daun jati (Tectona grandis Linn. f.) dilakukan di

II. MATERI DAN METODE. Tempat pengambilan sampel daun jati (Tectona grandis Linn. f.) dilakukan di II. MATERI DAN METODE 2.1 Waktu dan Tempat Penelitian Tempat pengambilan sampel daun jati (Tectona grandis Linn. f.) dilakukan di enam desa yaitu tiga desa di Kecamatan Grokgak dan tiga desa di Kecamatan

Lebih terperinci

BAB 3 PERCOBAAN. Alat elektroforesis agarosa (Biorad), autoklaf, cawan Petri, GeneAid High Speed Plasmid

BAB 3 PERCOBAAN. Alat elektroforesis agarosa (Biorad), autoklaf, cawan Petri, GeneAid High Speed Plasmid BAB 3 PERCOBAAN 3.1 Alat Alat elektroforesis agarosa (Biorad), autoklaf, cawan Petri, GeneAid High Speed Plasmid Mini kit, inkubator goyang (GSL), jarum Ose bundar, kit GFX (GE Healthcare), kompor listrik

Lebih terperinci

METODE PENELITIAN Waktu dan Tempat Penelitian Bahan Metode penelitian Isolasi RNA total

METODE PENELITIAN Waktu dan Tempat Penelitian Bahan Metode penelitian Isolasi RNA total METODE PENELITIAN Waktu dan Tempat Penelitian Penelitian ini dilakukan mulai bulan Februari 2005 hingga bulan Maret 2008 di Laboratorium Biologi Molekuler dan Seluler Tanaman dan Laboratorium BIORIN (Biotechnology

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN A. Jenis penelitian Jenis penelitian yang dilakukan adalah penelitian dasar dengan metode deskriptif (Nazir, 1988). B. Populasi dan sampel Populasi pada penelitian ini adalah

Lebih terperinci

METODE. Materi. Tabel 1. Jumlah Sampel DNA yang Digunakan dan Asal Pengambilan Sampel Darah.

METODE. Materi. Tabel 1. Jumlah Sampel DNA yang Digunakan dan Asal Pengambilan Sampel Darah. METODE Lokasi dan Waktu Penelitian ini dilaksanakan di Laboratorium Pemuliaan dan Genetika Molekuler, Bagian Pemuliaan dan Genetik Ternak, Departemen Ilmu Produksi dan Teknologi Peternakan, Fakultas Peternakan,

Lebih terperinci

BAB III METODE PENELITIAN. Penelitian yang dilakukan berupa penelitian murni yang dilakukan dengan

BAB III METODE PENELITIAN. Penelitian yang dilakukan berupa penelitian murni yang dilakukan dengan BAB III METODE PENELITIAN A. Jenis Penelitian Penelitian yang dilakukan berupa penelitian murni yang dilakukan dengan metode deskriptif, yaitu suatu metode penelitian untuk membuat deskripsi, gambaran

Lebih terperinci

BAHAN DAN METODE Waktu dan Tempat Penelitian Alat dan Bahan Alat Bahan

BAHAN DAN METODE Waktu dan Tempat Penelitian Alat dan Bahan Alat Bahan BAHAN DAN METODE Waktu dan Tempat Penelitian Penelitian dilakukan di Laboratorium Mikrobiologi dan Laboratorium Rekayasa Genetika Puslit Limnologi LIPI Cibinong, Laboratorium Bioremediasi Puslit Bioteknologi

Lebih terperinci

BAHAN DAN METODE. Analisis Kekerabatan Rayap Tanah M. gilvus dengan Pendekatan Perilaku

BAHAN DAN METODE. Analisis Kekerabatan Rayap Tanah M. gilvus dengan Pendekatan Perilaku BAHAN DAN METODE Tempat dan Waktu Sampel rayap diambil dari Cagar Alam Yanlappa-Jasinga dan Kampus IPB- Dramaga, Bogor. Rayap diidentifikasi dan diuji perilaku agonistiknya di Laboratorium Biosistematika

Lebih terperinci

METODE PENELITIAN. Bahan Penelitian

METODE PENELITIAN. Bahan Penelitian 35 METODE PENELITIAN Tempat dan Waktu Penelitian Metode yang digunakan dalam penelitian ini adalah metode eksperimen laboratorium. Penelitian ini dilakukan di Laboratorium Riset Fakultas Teknobiologi UNIKA

Lebih terperinci

Bab III Materi dan Metode

Bab III Materi dan Metode Bab III Materi dan Metode A. Materi Sampel yang digunakan adalah bakteri simbion dari lamun Enhalus acoroides yang ditumbuh di perairan Teluk Awur, Jepara. Isolasi bakteri simbion di laksanakan di laboratorium

Lebih terperinci

BAB III BAHAN DAN CARA KERJA. Penelitian dilakukan di Laboratorium Institute of Human Virology and

BAB III BAHAN DAN CARA KERJA. Penelitian dilakukan di Laboratorium Institute of Human Virology and 23 BAB III BAHAN DAN CARA KERJA A. LOKASI DAN WAKTU PENELITIAN Penelitian dilakukan di Laboratorium Institute of Human Virology and Cancer Biology of the University of Indonesia (IHVCB-UI), Jl. Salemba

Lebih terperinci

III. Bahan dan Metode

III. Bahan dan Metode III. Bahan dan Metode A. Waktu dan Tempat Penelitian Penelitian ini dilaksanakan selama 3 bulan dari bulan Mei-Juli 2011 yang dilakukan di LPPT UGM Yogyakarta. B. Bahan Penelitian Sampel yang digunakan

Lebih terperinci

BAHAN DAN METODE Tempat dan Waktu Bahan Pertumbuhan dan Peremajaan Isolat Pengamatan Morfologi Isolat B. thuringiensis

BAHAN DAN METODE Tempat dan Waktu Bahan Pertumbuhan dan Peremajaan Isolat Pengamatan Morfologi Isolat B. thuringiensis 13 BAHAN DAN METODE Tempat dan Waktu Penelitian ini dilaksanakan di Laboratorium Mikrobiologi, Departemen Biologi, IPB, dari bulan Oktober 2011 Mei 2012. Bahan Isolasi untuk memperoleh isolat B. thuringiensis

Lebih terperinci

BAB III BAHAN DAN METODE

BAB III BAHAN DAN METODE BAB III BAHAN DAN METODE 3.1 Waktu dan Tempat Penelitian Penelitian dilaksanakan pada bulan September sampai Oktober 2009. Pengambilan sampel susu dilakukan di beberapa daerah di wilayah Jawa Barat yaitu

Lebih terperinci

BAB III METODOLOGI PENELITIAN. Jenis penelitian yang digunakan adalah penelitian dasar dengan metode

BAB III METODOLOGI PENELITIAN. Jenis penelitian yang digunakan adalah penelitian dasar dengan metode 22 BAB III METODOLOGI PENELITIAN A. Jenis Penelitian Jenis penelitian yang digunakan adalah penelitian dasar dengan metode penelitian deskriptif. B. Lokasi dan Waktu Penelitian 1. Lokasi Penelitian Penelitian

Lebih terperinci

III. METODOLOGI A. BAHAN DAN ALAT C. METODE PENELITIAN

III. METODOLOGI A. BAHAN DAN ALAT C. METODE PENELITIAN III. METODOLOGI A. BAHAN DAN ALAT Bahan baku utama yang digunakan pada penelitian ini adalah rimpang jahe segar yang diperoleh dari Balai Penelitian Tanaman Aromatik dan Obat (Balitro) Bogor berumur 8

Lebih terperinci

LAMPIRAN. Lampiran 1. Foto Lokasi Pengambilan Sampel Air Panas Pacet Mojokerto

LAMPIRAN. Lampiran 1. Foto Lokasi Pengambilan Sampel Air Panas Pacet Mojokerto LAMPIRAN Lampiran 1. Foto Lokasi Pengambilan Sampel Air Panas Pacet Mojokerto Lampiran 2. Pembuatan Media dan Reagen 2.1 Pembuatan Media Skim Milk Agar (SMA) dalam 1000 ml (Amelia, 2005) a. 20 gram susu

Lebih terperinci

Sampel air kolam, usus ikan nila dan endapan air kolam ikan. Seleksi BAL potensial (uji antagonis)

Sampel air kolam, usus ikan nila dan endapan air kolam ikan. Seleksi BAL potensial (uji antagonis) Lampiran 1. Diagram Alir Penelitian Sampel air kolam, usus ikan nila dan endapan air kolam ikan. Seleksi BAL potensial (uji antagonis) Str Isolasi dan Karakteristik Bakteri Asam Laktat Isolat Bakteri Asam

Lebih terperinci