METODE PENELITIAN. Tempat dan Waktu. Bakteri Uji. Bahan dan Media

Ukuran: px
Mulai penontonan dengan halaman:

Download "METODE PENELITIAN. Tempat dan Waktu. Bakteri Uji. Bahan dan Media"

Transkripsi

1 39 METODE PENELITIAN Tempat dan Waktu Penelitian dilakukan di Laboratorium Patogen dan Bioteknologi Pangan (Southeast Asian Food and Agricultural Science and Technology) SEAFAST Center, Institut Pertanian Bogor. Penelitian berlangsung pada bulan Juni 2009 hingga Desember 2010 dan dilanjutkan pada bulan Juni 2010 hingga Juli Bakteri Uji Bakteri uji yang digunakan pada penelitian ini adalah sebanyak 14 isolat lokal S. aureus (AS, NU1, NU2, NU3, NU4, NU5, NU6, NU7, NU8, NU9, NU10, NU11, NU13 dan NU14) yang diisolasi dari ayam suwir dan nasi uduk sebagai salah satu produk pangan tradisional siap santap dan diperoleh dari daerah Babakan Raya, Bogor serta telah dilakukan uji biokimiawi oleh Apriyadi (2010). Isolat pembanding, yaitu S. aureus ATCC yang bersifat non-enterotoksigenik digunakan sebagai bakteri pembanding. Bahan dan Media Media-media yang digunakan untuk persiapan kultur bakteri S. aureus adalah TSB (Tryptone Soy Broth) (Becton and Dickinson, USA), TSA (Triptone Soy Agar) (CM 131 Oxoid Ltd., UK) dan BHI (Brain Heart Infussion) (Becton and Dickinson, USA). Beberapa bahan yang digunakan untuk isolasi DNA antara lain antara lain SDS (Sodium Dodecyl Sulphate) (Merck, Darmstadt, Germany), Tris (hydroxymethyl)-amino methan (Amerscham Bioscience, Sweden), NaCl (Natrium Chloride), sodium asetat, fenol (Sigma, USA), kloroform Merck, Darmstadt, Germany), isoamil alkohol (Merck, Darmstadt, Germany), etanol, lisozim (Bio Basic Inc), proteinase K (Fermentas), HCl (Merck, Darmstadt, Germany) dan akuabidestilata steril. Bahan-bahan yang digunakan untuk elektroforesis antara lain bufer TAE (Tris-asetat-EDTA), agarosa (GE Healthcare

2 40 Bio-Sciences AB), EtBr (Ethidium Bromide) (Amerscham Bioscience, Sweden), loading dye (Fermentas) serta Ladder DNA 100 bp dan 1 kb (Fermentas). Bahan-bahan yang digunakan untuk amplifikasi gen target, yaitu 16S rrna, gen penyandi enterotoksin stafilokoki A (SEA) dan enterotoksin stafilokoki C1 (SEC1) antara lain Green Dream Taq PCR MasterMix (Fermentas), water nuclease (Fermentas), cetakan DNA (DNA template) dan 3 pasang primer berturut-turut, yaitu 63f/1387r, SEA-1/SEA-2 dan SEC1-1/SEC1-2 (Tabel 10) (Marchesi et al., 1998; Johnson et al., 1991). Primer dipesan dari Alpha DNA (Notre-Dame St. W., Montreal, Quebec) (Johnson et al., 1991). Tabel 10 Pasangan primer oligonukleotida yang digunakan untuk amplifikasi gen target Kode Primer 63f 1387r SEA-1 SEA-2 SEC1-1 SEC1-2 Urutan Basa (5-3 ) CAG GCC TAA CAC ATG CAA GTC GGG CGG WGT GTA CAA GGC TTG GAA ACG GTT AAA ACG AA GAA CCT TCC CAT CAA AAA CA GAC ATA AAA GCT AGG AAT TT AAA TCG GAT TAA CAT TAT CC Gen Sumber Target 16S rrna Marchesi et al., (1998) SEA Johnson et al., (1991) SEC1 Johnson et al., (1991) Alat Alat-alat yang digunakan antara lain penangas air yang bertutup, termometer, inkubator 35 o C, mikroskop, jarum ose, tabung reaksi berulir, labu takar 50 ml, gelas ukur 50 ml, 100 ml dan 1000 ml; pipet mikro 2 ml, 20 ml, 100 ml dan 1000 ml; ph meter, vorteks, hot plate, alat sentrifus 18,000 rpm, pengaduk magnet, perangkat elektroforesis (Bio-Rad), perangkat PCR Applied Biosystem 2720 Thermal Cycler (Foster City, California), Geldoc XR (Bio-Rad), ABI Prism 3100-Avant Genetic Analyzer dengan 4-Capillary System (Applied Biosystem) dan spektrofotometer UV-Vis (Shimadzu). Beberapa software yang digunakan pada penelitian ini yaitu program BioEdit dan Program BLAST (Basic Local Alignment Search Tool) dari situs NCBI (www.ncbi. nlm.nih.gov) untuk menganalisis hasil sekuensing.

3 41 Pelaksanaan Penelitian Identifikasi secara morfologi dan biokimiawi terhadap 14 isolat lokal S. aureus diperoleh dari tahapan penelitian yang sudah dilakukan oleh Apriyadi (2010). Tahapan penelitian selanjutnya adalah melakukan identifikasi molekular yang meliputi: (a) isolasi DNA genom keempat belas isolat lokal S. aureus dan 1 isolat pembanding (S. aureus ATCC 25923) metode ekstraksi Doyle dan Doyle (1990) dengan beberapa modifikasi, (b) amplifikasi, visualisasi dan sekuensing gen 16S rrna untuk menentukan persen kemiripan antar isolat-isolat lokal S. aureus tersebut dengan menggunakan program BioEdit dan program BLAST dari situs NCBI (www.ncbi.nlm.nih.gov) dan (c) amplifikasi gen penyandi enterotoksin stafilokoki A (SEA) serta C1 (SEC1). Diagram alir pelaksanaan penelitian ditampilkan pada Gambar 3. Isolat S. aureus Persiapan kultur bakteri S. aureus dan pewarnaan Gram Spektrofotometri Isolasi DNA genom bakteri S. aureus dengan modifikasi dari metode ekstraksi Doyle dan Doyle (1989) Visualisasi Amplifikasi gen 16S rrna Sekuensing Amplifikasi gen SEA dan SEC1 Gambar 3 Diagram alir pelaksanaan penelitian

4 42 Persiapan dan Pewarnaan Gram Kultur Bakteri S. aureus Persiapan Kultur Bakteri Persiapan kultur dilakukan dengan cara bakteri S. aureus diinokulasikan ke dalam media TSA miring dan diinkubasi selama jam pada suhu 35 o C. Penyimpanan kultur dilakukan pada suhu 10 o C selama kurang lebih 2 minggu untuk kemudian dilakukan penyegaran kultur (BAM, 2001). Pewarnaan Gram Bakteri Kultur bakteri S. aureus pada media TSA miring diambil sebanyak satu ose ke dalam gelas objek, yang sebelumnya sudah digenangi akuades steril sebanyak dua ose dan setelah itu difiksasi. Selanjutnya ditambahkan kristal violet satu tetes selama 1 menit, dipastikan semua bagian lapisan digenangi larutan pewarna, lalu dibilas sempurna larutan kristal violet dengan air dan dikeringkan dengan kertas hisap, untuk kemudian ditambahkan iodium/lugol sebanyak satu tetes selama 1 menit. Larutan iodium/lugol dibilas kembali dengan akudes steril dan dikeringkan kembali, untuk selanjutnya ditambahkan alkohol 96% selama 5-15 detik hingga tidak ada lagi sisa pewarna violet yang mengalir. Selanjutnya ditambahkan larutan safranin satu tetes selama 1 menit, setelah itu dibilas dengan akuades steril dan dikeringkan, untuk kemudian diamati di bawah mikroskop (Harrigan, 1998). Identifikasi Molekuler Kultur Bakteri S. aureus Persiapan Kultur Bakteri Kultur bakteri dari media TSA miring diambil sebanyak satu ose ke dalam media BHI untuk kemudian diinkubasi selama semalam. Kultur bakteri S. aureus dari media BHI ini akan digunakan untuk melakukan isolasi DNA genom bakteri.

5 43 Isolasi DNA Genom Bakteri Isolasi DNA genom bakteri S. aureus dilakukan dengan metode Doyle dan Doyle (1990) yang telah dimodifikasi. Sel bakteri dari media BHI yang telah diinkubasi semalam dipanen melalui perlakuan sentrifugasi. Sebanyak 1.5 ml kultur bakteri dimasukkan ke dalam tabung Eppendorf 2.0 ml dan disentrifugasi pada 8,000 rpm selama 10 menit dengan suhu 4 o C. Pelet yang diperoleh diresuspensi dalam 1 ml NaCl 0.85% dan disentrifugasi pada 8,000 rpm selama 10 menit dengan suhu 4 o C. Pelet yang diperoleh kembali diresuspensi dalam 1 ml bufer TES dan disentrifugasi pada 8,000 rpm selama 10 menit dengan suhu 4 o C. Pelet yang diperoleh diresuspensi dalam 900 µl bufer TE, 100 µl SDS 10% dan 2 µl lisozim (2 mg/ml), untuk kemudian diinkubasi pada suhu 37 o C selama 1 jam. Selanjutnya, ditambahkan 2.5 µl proteinase-k (10 mg/ml) dan diinkubasi kembali pada suhu 65 o C selama 30 menit, dimana tiap 10 menit tabung dibolak-balik. Tahap selanjutnya ditambahkan 900 µl larutan phenol : chloroform : isoamilalcohol (PCI) (25:24:1), divorteks selama 3 menit dan disentrifugasi pada 8,000 rpm selama 10 menit dengan suhu 4 o C. Fase cairan (top layer) 400 µl dipindahkan ke tabung Eppendorf 2.0 ml yang baru, lalu ditambahkan 400 µl bufer TE, 40 µl SDS 10% dan larutan PCI (25:24:1) dengan volume yang sama (840 µl). Selanjutnya disentrifugasi pada 8,000 rpm selama 10 menit dengan suhu ruang (25 o C) untuk memisahkan fase campuran. Setelah itu, top layer dipindahkan kembali sebanyak 400 µl ke tabung Eppendorf 1.5 ml yang baru, lalu ditambahkan 0.1 volume sodium asetat 3 M ph 4.8 (40 µl) dan 2.0 volume etanol 100% (880 µl), kemudian dibolak-balik hingga tercampur merata. Tabung diinkubasi pada suhu -20 o C selama 1 jam, lalu DNA dipresipitasi dengan mensentrifugasi pada 13,500 rpm selama 10 menit dengan suhu 4 o C. Pelet ditambahkan 500 µl etanol 70% dan tabung dibolak-balikkan beberapa kali. Setelah itu disentrifugasi kembali pada 13,500 rpm selama 10 menit dengan suhu 4 o C. Pelet DNA dikeringkan dan diresuspensi dalam 40 µl akuabides steril. Untuk penyimpanan jangka panjang, larutan DNA disimpan pada suhu -20 o C. Verifikasi DNA dilakukan dengan elektroforesis menggunakan gel agarosa 1.5% dan 1x bufer TAE pada voltase 50 selama 45 menit. Gel kemudian diwarnai dengan

6 44 Ethidium Bromide (EtBr) dan divisualisasi pada panjang gelombang 302 nm (Geldoc XR, Bio-Rad). Uji kuantitas DNA genom hasil isolasi berupa kemurnian dan konsentrasi dilakukan dengan metode spektrofotometri pada panjang gelombang (λ) 260 nm dan 280 nm. Menurut Suharsono dan Widyastuti (2006), perhitungan kemurnian DNA diperoleh dari rasio nilai absorbansi (A) pada λ 260 nm dengan nilai absorbansi λ 280 nm atau seperti yang dirumuskan sebagai berikut: Kemurnian DNA = A λ 260 A λ 260 Perhitungan konsentrasi DNA diperoleh dari hasil perkalian antara nilai absorbansi pada panjang gelombang 260 nm dengan lima puluh dan faktor pengenceran seperti yang dirumuskan sebagai berikut: Konsentrasi DNA = A λ 260 x 50 x faktor pengenceran Amplifikasi Gen 16S rrna Bakteri Amplifikasi gen 16S rrna bakteri S. aureus dilakukan dengan menggunakan satu pasang primer, yaitu 63f dan 1387r (Marchesi et al, 1998). Protokol PCR yang digunakan adalah pre-pcr (95 o C, 3 menit), denaturasi (94 o C, 30 detik), penempelan primer (55 o C, 30 detik), elongasi atau pemanjangan primer (72 o C, 1 menit) dan post-pcr (72 o C, 5 menit) dengan siklus amplifikasi sebanyak 30 kali. Sebanyak 10 µl hasil PCR dielektroforesis pada gel agarosa 1.5% (w/v), dengan menggunakan 1x bufer TAE (Tris HCl- acetic acid-edta) pada voltase 50 selama 45 menit.

7 45 Sekuensing Gen 16S rrna Bakteri Fragmen DNA hasil PCR dimurnikan sebelum dilakukan sekuensing. Pemurnian produk PCR perlu dilakukan untuk mengurangi pengotor-pengotor berupa Mg 2+, DNA template dan dntp yang berlebih yang dapat mengganggu proses perunutan basa nukleotida sehingga dapat menimbulkan kesalahan dalam pembacaan hasil sekuensing (Applied Biosystem, 2002). Gen penyandi dari produk PCR yang telah diisolasi dan dimurnikan selanjutnya di-sekuensing dengan menggunakan ABI PRISM 3100-Avant Genetic Analyzer dengan 4-Capillary System (Applied Biosystem), dimana tahapan ini dilakukan di PT. Macrogen Inc., Seoul, Korea Selatan. Hasil sekuensing diolah dengan program BioEdit, kemudian dianalisis dengan menggunakan program BLAST dari NCBI (National Center of Biotechnology Information) pada situs (www.ncbi.nlm.nih.gov) untuk dibandingkan dengan data sekuen parsial gen 16S rrna dari beberapa galur S. aureus. Amplifikasi Gen Penyandi SEA dan SEC1 Untuk mengamplifikasi gen penyandi SEA digunakan primer SEA-1 dan SEA-2. Untuk SEC1 digunakan primer SEC1-1 dan SEC1-2 (Johnson et al., 1991). Protokol PCR yang digunakan untuk amplifikasi gen SEA adalah pre-pcr (95 o C, 3 menit), denaturasi (94 o C, 2 menit), penempelan primer (55 o C, 90 detik), elongasi atau pemanjangan primer (72 o C, 1 menit) dan post-pcr (72 o C, 5 menit) dengan siklus amplifikasi sebanyak 30 kali. Protokol PCR untuk amplifikasi gen SEC1 adalah pre-pcr (95 o C, 3 menit), denaturasi (94 o C, 30 detik), penempelan primer (54 o C, 30 detik), elongasi atau pemanjangan primer (72 o C, 1 menit) dan post-pcr (72 o C, 5 menit) dengan siklus amplifikasi sebanyak 30 kali. Hasil PCR sebanyak 10 µl dielektroforesis pada gel agarosa 1.5% (w/v), dengan menggunakan bufer 1x TAE pada voltase 70 selama 60 menit.

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN 3.1 Waktu dan Tempat Penelitian ini dilaksanakan pada bulan Januari 2012 sampai bulan Juli 2012, yang bertempat di Laboratorium Genetika dan Biologi Molekuler Jurusan Biologi

Lebih terperinci

MATERI DAN METODE. Kota Padang Sumatera Barat pada bulan Oktober Amplifikasi gen Growth

MATERI DAN METODE. Kota Padang Sumatera Barat pada bulan Oktober Amplifikasi gen Growth III. MATERI DAN METODE 3.1 Waktu dan Tempat Pengambilan sampel darah domba dilakukan di Kecamatan Koto Tengah Kota Padang Sumatera Barat pada bulan Oktober 2012. Amplifikasi gen Growth Hormone menggunakan

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN 25 BAB III METODE PENELITIAN 3.1 Waktu dan Tempat Penelitian telah berlangsung sejak bulan Januari 2012 - Juli 2012 di Laboratorium Mikrobiologi, Lab. Optik, Lab. Genetika dan Lab. Biologi Molekuler Jurusan

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN A. Jenis Penelitian Penelitian ini merupakan penelitian murni yang dilakukan dengan metode deskriptif, yaitu suatu metode penelitian untuk membuat deskripsi, gambaran atau lukisan

Lebih terperinci

BAB III METODE PENELITIAN Bagan Alir Penelitian ini secara umum dapat digambarkan pada skema berikut:

BAB III METODE PENELITIAN Bagan Alir Penelitian ini secara umum dapat digambarkan pada skema berikut: BAB III METODE PENELITIAN Tahapan-tahapan yang dilakukan dalam penelitian ini adalah: pengumpulan sampel, lisis terhadap sampel mtdna yang telah diperoleh, amplifikasi daerah HVI mtdna sampel dengan menggunakan

Lebih terperinci

LAPORAN II (ISOLASI DNA GENOM)

LAPORAN II (ISOLASI DNA GENOM) LAPORAN PRAKTIKUM REKAYASA GENETIKA LAPORAN II (ISOLASI DNA GENOM) KHAIRUL ANAM P051090031/BTK BIOTEKNOLOGI SEKOLAH PASCASARJANA INSTITUT PERTANIAN BOGOR 2010 0 ISOLASI DNA GENOM TUJUAN 16s rrna. Praktikum

Lebih terperinci

METODE Waktu dan Tempat Materi Sampel DNA Primer

METODE Waktu dan Tempat Materi Sampel DNA Primer METODE Waktu dan Tempat Penelitian ini dilaksanakan mulai bulan September 2010 sampai dengan bulan Pebruari 2011. Penelitian dilakukan di Laboratorium Genetika Molekuler Ternak Bagian Pemuliaan dan Genetika

Lebih terperinci

II. METODE PENELITIAN

II. METODE PENELITIAN II. METODE PENELITIAN 1. Materi, Lokasi, dan Waktu Penelitian 1.1. Materi Alat yang digunakan dalam penelitian ini adalah botol sampel, cawan petri, tabung reaksi, labu Erlenmeyer, beaker glass, object

Lebih terperinci

III. METODOLOGI PENELITIAN

III. METODOLOGI PENELITIAN III. METODOLOGI PENELITIAN A. BAHAN DAN ALAT 1. Bahan Bahan-bahan yang digunakan dalam penelitian ini antara lain media penyegaran mikroba, media pertumbuhan, media pemupukan mikroba, pengencer, medium

Lebih terperinci

BAB III METODOLOGI PENELITIAN. Pada penelitian ini terdapat lima tahapan penelitian yang dilakukan yaitu

BAB III METODOLOGI PENELITIAN. Pada penelitian ini terdapat lima tahapan penelitian yang dilakukan yaitu BAB III METODOLOGI PENELITIAN Pada penelitian ini terdapat lima tahapan penelitian yang dilakukan yaitu pengumpulan sampel berupa akar rambut, ekstraksi mtdna melalui proses lisis akar rambut, amplifikasi

Lebih terperinci

Penelitian ini dilakukan di laboratorium Mikrobiologi Pangan Universitas Katolik Soegijapranata pada Agustus 2013 hingga Januari 2014.

Penelitian ini dilakukan di laboratorium Mikrobiologi Pangan Universitas Katolik Soegijapranata pada Agustus 2013 hingga Januari 2014. 2. MATERI DAN METODE 2.1. Waktu dan Tempat Penelitian Penelitian ini dilakukan di laboratorium Mikrobiologi Pangan Universitas Katolik Soegijapranata pada Agustus 2013 hingga Januari 2014. 2.2. Materi

Lebih terperinci

BAB III METODE A. Jenis Penelitian B. Populasi dan Sampel C. Waktu dan Lokasi Penelitian D. Alat dan Bahan Rizki Indah Permata Sari,2014

BAB III METODE A. Jenis Penelitian B. Populasi dan Sampel C. Waktu dan Lokasi Penelitian D. Alat dan Bahan Rizki Indah Permata Sari,2014 34 BAB III METODE A. Jenis Penelitian Penelitian ini merupakan penelitian murni atau pure research yang dilakukan dengan metode deskriptif, yaitu suatu metode penelitian untuk membuat deskripsi, gambaran

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN 3.1 Rancangan Penelitian Penelitian tentang Karakterisasi genetik Udang Jari (Metapenaeus elegans De Man, 1907) hasil tangkapan dari Laguna Segara Anakan berdasarkan haplotipe

Lebih terperinci

LAMPIRAN. Lampiran 1. Pembuatan Larutan Stok dan Buffer

LAMPIRAN. Lampiran 1. Pembuatan Larutan Stok dan Buffer LAMPIRAN Lampiran 1. Pembuatan Larutan Stok dan Buffer A. LARUTAN STOK CTAB 5 % (100 ml) - Ditimbang NaCl sebanyak 2.0 gram - Ditimbang CTAB sebanyak 5.0 gram. - Dimasukkan bahan kimia ke dalam erlenmeyer

Lebih terperinci

Air Panas. Isolat Murni Bakteri. Isolat Bakteri Selulolitik. Isolat Terpilih Bakteri Selulolitik. Kuantitatif

Air Panas. Isolat Murni Bakteri. Isolat Bakteri Selulolitik. Isolat Terpilih Bakteri Selulolitik. Kuantitatif 75 Lampiran 1. Metode Kerja L.1.1 Bagan kerja Air Panas - Isolasi dan Seleksi Bakteri Pemurnian Bakteri Isolat Murni Bakteri Uji Bakteri Penghasil Selulase Secara Kualitatif Isolat Bakteri Selulolitik

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN 3.1 Tempat dan Waktu Penelitian Kegiatan penelitan ini meliputi kegiatan kultivasi kandidat bakteri probiotik dari saluran pencernaan ikan sidat (Anguilla bicolor), uji aktivitas

Lebih terperinci

3 Metode Penelitian. 3.1 Alat

3 Metode Penelitian. 3.1 Alat 3 Metode Penelitian 3.1 Alat Peralatan yang digunakan pada penelitian ini adalah peralatan gelas standar meliputi: labu erlenmeyer, cawan petri, gelas ukur, gelas kimia, botol reagen, tabung reaksi, batang

Lebih terperinci

BAHAN DAN METODE Tempat dan Waktu Penelitian Bahan dan Alat

BAHAN DAN METODE Tempat dan Waktu Penelitian Bahan dan Alat 12 BAHAN DAN METODE Tempat dan Waktu Penelitian Survei penyakit klorosis dan koleksi sampel tanaman tomat sakit dilakukan di sentra produksi tomat di daerah Cianjur, Cipanas, Lembang, dan Garut. Deteksi

Lebih terperinci

FAKULTAS BIOLOGI LABORATORIUM GENETIKA & PEMULIAAN INSTRUKSI KERJA UJI

FAKULTAS BIOLOGI LABORATORIUM GENETIKA & PEMULIAAN INSTRUKSI KERJA UJI Halaman : 1 dari 5 ISOLASI TOTAL DNA HEWAN DENGAN KIT EKSTRAKSI DNA 1. RUANG LINGKUP Metode ini digunakan untuk mengisolasi DNA dari sampel jaringan hewan, dapat dari insang, otot, darah atau jaringan

Lebih terperinci

METODOLOGI PENELITIAN

METODOLOGI PENELITIAN II. METODOLOGI PENELITIAN A. Tempat dan Waktu Penelitian Penelitian ini dilaksanakan di Pusat Riset Obat dan Makanan Badan POM RI pada bulan April 2011 hingga Juli 2011. B. Bahan Bahan-bahan yang digunakan

Lebih terperinci

BAB 3 PERCOBAAN 3.1 Bahan 3.2 Alat

BAB 3 PERCOBAAN 3.1 Bahan 3.2 Alat BAB 3 PERCOBAAN 3.1 Bahan Bahan yang digunakan memiliki kualitas pro analisis atau pro biologi molekular, yaitu : primer M. tuberculosis forward: 5 GGATCCGATGAGCAAGCTGATCGAA3 (Proligo) dan primer M. tuberculosis

Lebih terperinci

BAB 3 PERCOBAAN Mikroba C. violaceum, Bacillus cereus dan E. coli JM 109

BAB 3 PERCOBAAN Mikroba C. violaceum, Bacillus cereus dan E. coli JM 109 9 BAB 3 PERCOBAAN 3.1 Alat, Bahan dan Miroba 3.1.1 Alat Bunsen, inkubator 37 o C, sentrifuga (Mikro 200R Hettich), Eppendorf 100 ul, 500 ul, 1,5 ml, tabung mikrosentrifuga (Eppendorf), neraca timbang (Mettler

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN A. Jenis penelitian Jenis penelitian ini adalah penelitian deskriptif yang mengangkat fenomena alam sebagai salah satu masalah dalam penelitian, sehingga dapat menerangkan arti

Lebih terperinci

BAB III BAHAN DAN METODE

BAB III BAHAN DAN METODE BAB III BAHAN DAN METODE 3.1. Tempat dan Waktu Penelitian 3.1.1. Tempat Penelitian Penelitian dilaksanakan di Laboratorium Bioteknologi Perikanan dan Kelautan Fakultas Perikanan dan Ilmu Kelautan Universitas

Lebih terperinci

Metodologi Penelitian. Metode, bahan dan alat yang digunakan dalam penelitian ini akan dipaparkan pada bab ini.

Metodologi Penelitian. Metode, bahan dan alat yang digunakan dalam penelitian ini akan dipaparkan pada bab ini. Bab III Metodologi Penelitian Metode, bahan dan alat yang digunakan dalam penelitian ini akan dipaparkan pada bab ini. III.1 Rancangan Penelitian Secara garis besar tahapan penelitian dijelaskan pada diagram

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN A. Jenis Penelitian Jenis penelitian yang digunakan adalah penelitian dasar dengan metode deskriptif (Nazir, 1983). B. Populasi dan Sampel Populasi dalam penelitian ini adalah

Lebih terperinci

III. Bahan dan Metode

III. Bahan dan Metode III. Bahan dan Metode A. Bahan Sampel yang digunakan adalah bakteri penghasil biopigmen hasil isolasi dari Acropora nasuta yang diambil dari Taka Cemara Karimunjawa, Jepara, Jawa Tengah. Bahan kimia yang

Lebih terperinci

METODE PENELITIAN. Bahan Penelitian

METODE PENELITIAN. Bahan Penelitian 35 METODE PENELITIAN Tempat dan Waktu Penelitian Metode yang digunakan dalam penelitian ini adalah metode eksperimen laboratorium. Penelitian ini dilakukan di Laboratorium Riset Fakultas Teknobiologi UNIKA

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN A. Jenis penelitian Jenis penelitian yang dilakukan adalah penelitian dasar dengan metode deskriptif (Nazir, 1988). B. Populasi dan sampel Populasi pada penelitian ini adalah

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN A. Jenis Penelitian Jenis penelitian yang dilakukan adalah penelitian dasar dengan metode deskriptif, yaitu metode penelitian yang dibuat deskripsi, gambaran atau lukisan secara

Lebih terperinci

METODE PENELITIAN. Penelitian ini dilakukan dari Bulan April sampai dengan Juni 2013, di

METODE PENELITIAN. Penelitian ini dilakukan dari Bulan April sampai dengan Juni 2013, di 17 III. METODE PENELITIAN A. Waktu dan Tempat Penelitian ini dilakukan dari Bulan April sampai dengan Juni 2013, di Laboratorium Mikrobiologi Fakultas Matematika dan Ilmu Pengetahuan Alam, Universitas

Lebih terperinci

1 0,53 0,59 2 0,3 0,2 3 0,02 0,02 4 0,04 0,04 5 0,3 0,3 Ilustrasi rangkaian isolasi DNA tersebut dapat dilihat pada Gambar 1 berikut.

1 0,53 0,59 2 0,3 0,2 3 0,02 0,02 4 0,04 0,04 5 0,3 0,3 Ilustrasi rangkaian isolasi DNA tersebut dapat dilihat pada Gambar 1 berikut. PERBANDINGAN BEBERAPA METODE ISOLASI DNA UNTUK PENENTUAN KUALITAS LARUTAN DNA TANAMAN SINGKONG (Manihot esculentum L.) Molekul DNA dalam suatu sel dapat diekstraksi atau diisolasi untuk berbagai macam

Lebih terperinci

III. MATERI DAN METODE. Sultan Syarif Kasim Riau Pekanbaru pada bulan Mei 2013 sampai dengan Juni 2013.

III. MATERI DAN METODE. Sultan Syarif Kasim Riau Pekanbaru pada bulan Mei 2013 sampai dengan Juni 2013. III. MATERI DAN METODE 3.1. Tempat dan Waktu Penelitian ini telah dilaksanakan di laboratorium Patologi Entomologi dan Mikrobiologi (PEM) Fakultas Pertanian dan Peternakan Universitas Islam Negeri Sultan

Lebih terperinci

III. METODOLOGI PENELITIAN. Penelitian ini dilakukan pada bulan Agustus-Desember 2015 di Laboratorium

III. METODOLOGI PENELITIAN. Penelitian ini dilakukan pada bulan Agustus-Desember 2015 di Laboratorium 23 III. METODOLOGI PENELITIAN A. Waktu dan Tempat Penelitian Penelitian ini dilakukan pada bulan Agustus-Desember 2015 di Laboratorium Biokimia Jurusan Kimia Fakultas Matematika dan Ilmu Pengetahuan Alam

Lebih terperinci

Sampel air panas. Pengenceran 10-1

Sampel air panas. Pengenceran 10-1 Lampiran 1. Metode kerja Sampel air panas Diambil 10 ml Dicampur dengan media selektif 90ml Di inkubasi 24 jam, suhu 50 C Pengenceran 10-1 Di encerkan sampai 10-10 Tiap pengenceran di tanam di cawan petri

Lebih terperinci

Bab III Metode Penelitian

Bab III Metode Penelitian Bab III Metode Penelitian Metode yang dilakukan dalam penelitian ini terdiri dari empat tahapan, dimulai dengan pengumpulan sampel, kemudian lysis sel untuk mendapatkan template DNA, amplifikasi DNA secara

Lebih terperinci

BAB III METODE PENELITIAN. Biologi dan Laboratorium Biokimia, Departemen Kimia Fakultas Sains dan

BAB III METODE PENELITIAN. Biologi dan Laboratorium Biokimia, Departemen Kimia Fakultas Sains dan BAB III METODE PENELITIAN 3.1 Tempat dan Waktu Penelitian Penelitian ini dilaksanakan di Laboratorium Mikrobiologi, Departemen Biologi dan Laboratorium Biokimia, Departemen Kimia Fakultas Sains dan Teknologi,

Lebih terperinci

BAB III METODE PENELITIAN. Jenis penelitian ini merupakan jenis penelitian deskriptif untuk karakterisasi

BAB III METODE PENELITIAN. Jenis penelitian ini merupakan jenis penelitian deskriptif untuk karakterisasi 26 BAB III METODE PENELITIAN A. Jenis Penelitian Jenis penelitian ini merupakan jenis penelitian deskriptif untuk karakterisasi gen virulen dan eksperimental pada uji patogenesitas dengan menggunakan LD

Lebih terperinci

BAHAN DAN METODE. Metode Penelitian

BAHAN DAN METODE. Metode Penelitian BAHAN DAN METODE Tempat dan Waktu Penelitian Survei penyakit mosaik dan koleksi sampel tanaman nilam sakit dilakukan di Kebun Percobaan Balai Tanaman Obat dan Aromatik (BALITTRO) di daerah Gunung Bunder

Lebih terperinci

LAPORAN PRAKTIKUM REKAYASA GENETIKA

LAPORAN PRAKTIKUM REKAYASA GENETIKA LAPORAN PRAKTIKUM REKAYASA GENETIKA LAPORAN IV (ISOLASI RNA DARI TANAMAN) KHAIRUL ANAM P051090031/BTK BIOTEKNOLOGI SEKOLAH PASCASARJANA INSTITUT PERTANIAN BOGOR 2010 0 ISOLASI RNA DARI TANAMAN TUJUAN Tujuan

Lebih terperinci

Gambar 2 Vektor pengklonan pgem T Easy

Gambar 2 Vektor pengklonan pgem T Easy BAHAN DAN METODE Waktu dan Tempat Penelitian ini dilaksanakan dari bulan September 2007 sampai dengan bulan April 2008. Penelitian dilakukan di Laboratorium Biologi Molekuler Seluler Tanaman, dan Laboratorium

Lebih terperinci

3 METODOLOGI 3.1 Waktu dan Tempat 3.2 Bahan dan Alat

3 METODOLOGI 3.1 Waktu dan Tempat 3.2 Bahan dan Alat 3 METODOLOGI 3.1 Waktu dan Tempat Penelitian dilakukan selama bulan Januari hingga April 2010 bertempat di Laboratorium Karakteristik Bahan Baku, Departemen Teknologi Hasil Perairan, Fakultas Perikanan

Lebih terperinci

PETUNJUK PRAKTIKUM BIOLOGI SEL DAN MOLEKULER Oleh: Ixora Sartika M ISOLASI DNA PLASMID

PETUNJUK PRAKTIKUM BIOLOGI SEL DAN MOLEKULER Oleh: Ixora Sartika M ISOLASI DNA PLASMID PETUNJUK PRAKTIKUM BIOLOGI SEL DAN MOLEKULER Oleh: Ixora Sartika M ixomerc@uny.ac.id ISOLASI DNA PLASMID Plasmid adalah DNA ekstrakromosom yang berbentuk sirkuler dan berukuran kecil (1 200 kb). Sebagian

Lebih terperinci

III. METODOLOGI PENELITIAN. Penelitian ini dilakukan pada bulan Juni sampai Desember 2013 dengan tahapan

III. METODOLOGI PENELITIAN. Penelitian ini dilakukan pada bulan Juni sampai Desember 2013 dengan tahapan 20 III. METODOLOGI PENELITIAN A. Waktu dan Tempat Penelitian Penelitian ini dilakukan pada bulan Juni sampai Desember 2013 dengan tahapan kegiatan, yaitu pengambilan sampel, isolasi dan identifikasi bakteri

Lebih terperinci

1. Kualitas DNA total Udang Jari (Metapenaeus elegans De Man, 1907) Hasil. Tangkapan dari Laguna Segara Anakan, Cilacap, Jawa Tengah dengan

1. Kualitas DNA total Udang Jari (Metapenaeus elegans De Man, 1907) Hasil. Tangkapan dari Laguna Segara Anakan, Cilacap, Jawa Tengah dengan Lampiran 1. Data dan analisis karakterisasi genetik Udang Jari (Metapenaeus elegans De Man, 1907) Hasil Tangkapan dari Laguna Segara Anakan, Cilacap, Jawa Tengah. 1. Kualitas DNA total Udang Jari (Metapenaeus

Lebih terperinci

MATERI DAN METODE PENELITIAN

MATERI DAN METODE PENELITIAN II. MATERI DAN METODE PENELITIAN A. Materi, Lokasi, dan Waktu Penelitian 1. Materi Penelitian 1.1. Alat Alat yang digunakan dalam penelitian ini adalah labu Erlenmeyer, 1.2. Bahan beaker glass, tabung

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN 3.1 Waktu dan Tempat Penelitian Penelitian dilaksanakan pada bulan Maret hingga September 2013. Sampling Gracilaria sp., Sargassum sp. dan air laut dilakukan di perairan Santolo

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN 18 BAB III METODE PENELITIAN A. Jenis Penelitian Jenis penelitian ini merupakan jenis penelitian deskriptif. Penelitian deskriptif merupakan penelitian yang bertujuan untuk membuat deskripsi, gambaran

Lebih terperinci

BAB III METODE PENELITIAN. Februari sampai Juli 2012 di Laboratorium Mikrobiologi Departemen Biologi,

BAB III METODE PENELITIAN. Februari sampai Juli 2012 di Laboratorium Mikrobiologi Departemen Biologi, BAB III METODE PENELITIAN 3.1 Tempat dan Waktu Penelitian Penelitian ini akan dilaksanakan selama 6 (enam) bulan yaitu pada bulan Februari sampai Juli 2012 di Laboratorium Mikrobiologi Departemen Biologi,

Lebih terperinci

BAHAN DAN METODE. Penelitian ini dilaksanakan di Laboratorium Analisis Hasil Pertanian dan

BAHAN DAN METODE. Penelitian ini dilaksanakan di Laboratorium Analisis Hasil Pertanian dan III. BAHAN DAN METODE 3.1. Tempat dan Waktu Penelitian Penelitian ini dilaksanakan di Laboratorium Analisis Hasil Pertanian dan Laboratorium Mikrobiologi Hasil Pertanian, Jurusan Teknologi Hasil Pertanian,

Lebih terperinci

BAHAN DAN METODE. Tempat dan Waktu Penelitian. Alat dan Bahan

BAHAN DAN METODE. Tempat dan Waktu Penelitian. Alat dan Bahan BAHAN DAN METODE Tempat dan Waktu Penelitian Penelitian diawali dengan pengambilan sampel susu pasteurisasi impor dari Australia melalui Pelabuhan Udara Soekarno-Hatta. Pengujian dilakukan di Balai Uji

Lebih terperinci

METODE PENELITIAN. A. Tempat dan Waktu

METODE PENELITIAN. A. Tempat dan Waktu 10 III. METODE PENELITIAN A. Tempat dan Waktu Penelitian dilaksanakan pada bulan September 2015 sampai Februari 2016. Isolasi dan visualisasi RNA Colletrotichum dilaksanakan di Laboratorium Hama Penyakit

Lebih terperinci

III. BAHAN DAN METODE. Penelitian ini dilaksanakan di Laboratorium Kimia/Biokimia Hasil Pertanian dan

III. BAHAN DAN METODE. Penelitian ini dilaksanakan di Laboratorium Kimia/Biokimia Hasil Pertanian dan 18 III. BAHAN DAN METODE 3.1 Tempat dan Waktu Penelitian Penelitian ini dilaksanakan di Laboratorium Kimia/Biokimia Hasil Pertanian dan Laboratorium Mikrobiologi Hasil Pertanian Jurusan Teknologi Hasil

Lebih terperinci

BAB IV HASIL DAN PEMBAHASAN. Pada uji pendahuluan dilakukan isolasi DNA menggunakan CTAB.

BAB IV HASIL DAN PEMBAHASAN. Pada uji pendahuluan dilakukan isolasi DNA menggunakan CTAB. BAB IV HASIL DAN PEMBAHASAN A. HASIL PENELITIAN Pada uji pendahuluan dilakukan isolasi DNA menggunakan CTAB. Isolasi DNA dari kultur murni Escherichia coli ATCC 25922 menggunakan CTAB memastikan bahwa

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN 3.1. Lokasi Penelitian Penelitian ini dilaksanakan pada bulan Februari hingga Juli 2013 di Laboratorium Kimia Riset Makanan dan Material Jurusan Pendidikan Kimia FMIPA Universitas

Lebih terperinci

BAB 3 PERCOBAAN 3.1 Bahan Percobaan 3.2 Alat Percobaan

BAB 3 PERCOBAAN 3.1 Bahan Percobaan 3.2 Alat Percobaan BAB 3 PERCOBAAN 3.1 Bahan Percobaan Agarosa (MD Bio), akrilamid (Promega), bisakrilamid (Promega), amonium oksalat (Bratachem), Bacto Triptone (Difco), fuchsin basa (Bratachem), Bovine Serum Albumin (BSA),

Lebih terperinci

BAHAN DAN METODE. Pengambilan sampel tanah. Isolasi bakteri dari biakan pengkayaan mengandung NO 3. Uji oksidatif/fermentatif.

BAHAN DAN METODE. Pengambilan sampel tanah. Isolasi bakteri dari biakan pengkayaan mengandung NO 3. Uji oksidatif/fermentatif. 37 BAHAN DAN METODE Waktu dan Tempat Penelitian Penelitian berlangsung mulai September 2007 sampai dengan Juli 2010 dengan beberapa tahap percobaan (Gambar 4). Sampel tanah sawah diambil dari enam lokasi

Lebih terperinci

BAB III METODE PENELITIAN. Jurusan Biologi Fakultas Sains dan Teknologi Universitas Islam Negeri Maulana

BAB III METODE PENELITIAN. Jurusan Biologi Fakultas Sains dan Teknologi Universitas Islam Negeri Maulana BAB III METODE PENELITIAN 3.1 Waktu dan Tempat Penelitian Penelitian ini dilaksanakan di Laboratorium Mikrobiologi dan Genetika Jurusan Biologi Fakultas Sains dan Teknologi Universitas Islam Negeri Maulana

Lebih terperinci

LAMPIRAN. Lampiran 1. Pembuatan reagen-reagen untuk tahapan ekstraksi DNA. bio.unsoed.ac.id

LAMPIRAN. Lampiran 1. Pembuatan reagen-reagen untuk tahapan ekstraksi DNA. bio.unsoed.ac.id LAMPIRAN Lampiran 1. Pembuatan reagen-reagen untuk tahapan ekstraksi DNA a. Reagen FeCl 3 200 mm FeCl 3 2,7 g Akuades 5 ml FeCl 3 dilarutkan ke dalam akuades yang telah disterilisasi menggunakan autoklaf

Lebih terperinci

III. METODOLOGI PENELITIAN. Penelitian ini telah dilaksanakan pada Oktober 2014 sampai dengan Februari

III. METODOLOGI PENELITIAN. Penelitian ini telah dilaksanakan pada Oktober 2014 sampai dengan Februari 30 III. METODOLOGI PENELITIAN A. Waktu dan Tempat Penelitian ini telah dilaksanakan pada Oktober 2014 sampai dengan Februari 2015, dengan tahapan kegiatan pengambilan sampel kulit udang di P.T Lola Mina,

Lebih terperinci

BAB III METODE PENELITIAN. Penelitian ini merupakan jenis penelitian terapan dengan menggunakan

BAB III METODE PENELITIAN. Penelitian ini merupakan jenis penelitian terapan dengan menggunakan BAB III METODE PENELITIAN A. Jenis Penelitian Penelitian ini merupakan jenis penelitian terapan dengan menggunakan metode eksperimen karena terdapat perlakuan untuk memanipulasi objek penelitian dan diperlukan

Lebih terperinci

III. METODOLOGI PENELITIAN. Penelitian ini dilaksanakan dari bulan Maret sampai bulan Agustus 2013 di

III. METODOLOGI PENELITIAN. Penelitian ini dilaksanakan dari bulan Maret sampai bulan Agustus 2013 di 25 III. METODOLOGI PENELITIAN A. Waktu dan Tempat Penelitian Penelitian ini dilaksanakan dari bulan Maret sampai bulan Agustus 2013 di Laboratorium Instrumentasi dan Laboratorium Biokimia Jurusan Kimia

Lebih terperinci

LAPORAN PRAKTIKUM REKAYASA GENETIKA

LAPORAN PRAKTIKUM REKAYASA GENETIKA LAPORAN PRAKTIKUM REKAYASA GENETIKA LAPORAN II (ISOLASI DNA GENOM) KHAIRUL ANAM P051090031/BTK BIOTEKNOLOGI SEKOLAH PASCASARJANA INSTITUT PERTANIAN BOGOR 2010 0 ISOLASI DAN IDENTIFIKASI DNA SEL MUKOSA

Lebih terperinci

3. METODOLOGI PENELITIAN

3. METODOLOGI PENELITIAN 3. METODOLOGI PENELITIAN 3.1. Waktu dan tempat Penelitian Penelitian telah dilaksanakan dari bulan Agustus 2006 sampai Juli 2007, bertempat di Laboratorium Bioteknologi Hasil Perairan Departemen Teknologi

Lebih terperinci

o C 1 menit, penempelan 50 o C 1 menit, polimerisasi 72 o C 1 menit (tiga tahap ini

o C 1 menit, penempelan 50 o C 1 menit, polimerisasi 72 o C 1 menit (tiga tahap ini 13 BAB IV PERCOBAAN IV.1 Bahan Air miliq, deoksinukleotida trifosfat (dntp), MgCl 2, (Promega), enzim Pfu DNA polymerase, dapar Pfu (Stratagene), oligonukleotida SR1, SR2, SR3, SR4, SR5, AR6, AR7, AR8,

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN 3.1 Waktu dan Tempat Penelitian dilaksanakan selama 2 bulan pada bulan Maret sampai dengan Juni 2013 yang bertempat di Laboraturium Bioteknologi FPIK UNPAD kampus Jatinangor.

Lebih terperinci

LAPORAN I (ISOLASI DAN PEMETAAN DNA PLASMID)

LAPORAN I (ISOLASI DAN PEMETAAN DNA PLASMID) LAPORAN PRAKTIKUM REKAYASA GENETIKA LAPORAN I (ISOLASI DAN PEMETAAN DNA PLASMID) KHAIRUL ANAM P051090031/BTK BIOTEKNOLOGI SEKOLAH PASCASARJANA INSTITUT PERTANIAN BOGOR 2010 0 ISOLASI DAN PEMETAAN DNA PLASMID

Lebih terperinci

III. METODOLOGI PENELITIAN. Penelitian ini sudah dilaksanakan dari bulan Februari sampai bulan Juli 2013 di

III. METODOLOGI PENELITIAN. Penelitian ini sudah dilaksanakan dari bulan Februari sampai bulan Juli 2013 di 24 III. METODOLOGI PENELITIAN A. Waktu dan Tempat Penelitian Penelitian ini sudah dilaksanakan dari bulan Februari sampai bulan Juli 2013 di Laboratorium Instrumentasi dan Biokimia Jurusan Kimia FMIPA

Lebih terperinci

BAB 4 METODE PENELITIAN. 4.1 Jenis Penelitian Penelitian ini merupakan penelitian eksperimental laboratorik.

BAB 4 METODE PENELITIAN. 4.1 Jenis Penelitian Penelitian ini merupakan penelitian eksperimental laboratorik. BAB 4 METODE PENELITIAN 4.1 Jenis Penelitian Penelitian ini merupakan penelitian eksperimental laboratorik. 4.2 Waktu Penelitian Oktober - November 2008. 4.3 Lokasi Penelitian Laboratorium Biologi Mulut

Lebih terperinci

SOAL LATIHAN UAS MATA KULIAH KETRAMPILAN DASAR LABORATORIUM BIOMEDIK. Bentuk UAS tahun ini: Ada 3 bagian:

SOAL LATIHAN UAS MATA KULIAH KETRAMPILAN DASAR LABORATORIUM BIOMEDIK. Bentuk UAS tahun ini: Ada 3 bagian: SOAL LATIHAN UAS MATA KULIAH KETRAMPILAN DASAR LABORATORIUM BIOMEDIK Bentuk UAS tahun ini: Ada 3 bagian: 1. CARA KERJA Soal praktek pada UAS lebih rumit dari pada UTS di mana Anda akan diuji atas sebagian

Lebih terperinci

Laporan Praktikum Isolasi DNA, Teknik PCR dan Elektroforesis Agarose

Laporan Praktikum Isolasi DNA, Teknik PCR dan Elektroforesis Agarose Laporan Praktikum Isolasi DNA, Teknik PCR dan Elektroforesis Agarose Hari / Tanggal Praktikum : Kamis / 1 November dan 22 November 2012 Nama Praktikan : Rica Vera Br. Tarigan dan Jekson Martiar Siahaan

Lebih terperinci

4 HASIL DAN PEMBAHASAN

4 HASIL DAN PEMBAHASAN 24 4 HASIL DAN PEMBAHASAN 4.1 Isolasi dan Purifikasi Bakteri Isolasi merupakan proses pemindahan organisme dari habitat asli ke dalam suatu habitat baru untuk dapat dikembangbiakkan. Purifikasi merupakan

Lebih terperinci

BAB III METODE PENELITIAN. dengan mengadakan manipulasi terhadap objek penelitian serta adanya kontrol

BAB III METODE PENELITIAN. dengan mengadakan manipulasi terhadap objek penelitian serta adanya kontrol 24 BAB III METODE PENELITIAN A. Jenis Penelitian Penelitian yang dilakukan termasuk penelitian dasar dengan metode penelitian eksperimen. Penelitian eksperimen adalah penelitian yang dilakukan dengan mengadakan

Lebih terperinci

BAB III METODOLOGI PENELITIAN. Penelitian yang dilakukan termasuk ke dalam penelitian dasar dimana adanya

BAB III METODOLOGI PENELITIAN. Penelitian yang dilakukan termasuk ke dalam penelitian dasar dimana adanya BAB III METODOLOGI PENELITIAN A. Jenis Penelitian Penelitian yang dilakukan termasuk ke dalam penelitian dasar dimana adanya keingintahuan peneliti terhadap hasil suatu aktivitas. Metode penelitian ini

Lebih terperinci

BAB III METODE PENELITIAN. adalah variasi jenis kapang yaitu Penicillium sp. dan Trichoderma sp. dan

BAB III METODE PENELITIAN. adalah variasi jenis kapang yaitu Penicillium sp. dan Trichoderma sp. dan BAB III METODE PENELITIAN 3.1 Rancangan Penelitian Rancangan yang digunakan dalam penelitian ini adalah rancangan acak lengkap (RAL) pola faktorial yang terdiri dari 2 faktor. Faktor pertama adalah variasi

Lebih terperinci

BAB III BAHAN DAN CARA KERJA. Penelitian dilakukan di Laboratorium Teknologi Bioindustri, Pusat

BAB III BAHAN DAN CARA KERJA. Penelitian dilakukan di Laboratorium Teknologi Bioindustri, Pusat BAB III BAHAN DAN CARA KERJA A. LOKASI DAN WAKTU PENELITIAN Penelitian dilakukan di Laboratorium Teknologi Bioindustri, Pusat Teknologi Bioindustri, Badan Pengkajian dan Penerapan Teknologi (LTB- PTB-BPPT)-Serpong.

Lebih terperinci

Isolasi dan Karakterisasi Gen Penyandi Protein Permukaan VP28 White Spot Syndrome Virus (WSSV) pada Udang Windu (Penaeus monodon Fabricius, 1798)

Isolasi dan Karakterisasi Gen Penyandi Protein Permukaan VP28 White Spot Syndrome Virus (WSSV) pada Udang Windu (Penaeus monodon Fabricius, 1798) Isolasi dan Karakterisasi Gen Penyandi Protein Permukaan VP28 White Spot Syndrome Virus (WSSV) pada Udang Windu (Penaeus monodon Fabricius, 1798) Asmi Citra Malina 1, Andi Aliah Hidayani 1 dan Andi Parenrengi

Lebih terperinci

III. METODOLOGI. 1. Analisis Kualitatif Natrium Benzoat (AOAC B 1999) Persiapan Sampel

III. METODOLOGI. 1. Analisis Kualitatif Natrium Benzoat (AOAC B 1999) Persiapan Sampel III. METODOLOGI A. BAHAN DAN ALAT Bahan-bahan yang digunakan dalam penelitian ini adalah saus sambal dan minuman dalam kemasan untuk analisis kualitatif, sedangkan untuk analisis kuantitatif digunakan

Lebih terperinci

3 Percobaan. 3.1 Bahan Penelitian. 3.2 Peralatan

3 Percobaan. 3.1 Bahan Penelitian. 3.2 Peralatan 3 Percobaan 3.1 Bahan Penelitian Bahan-bahan yang digunakan dalam penelitian ini adalah air kelapa, gula pasir yang diperoleh dari salah satu pasar di Bandung. Zat kimia yang digunakan adalah (NH 4 ) 2

Lebih terperinci

LAPORAN PRAKTIKUM GENETIKA MOLEKULAR HIBRIDISASI SOUTHERN KHAIRUL ANAM P /BTK

LAPORAN PRAKTIKUM GENETIKA MOLEKULAR HIBRIDISASI SOUTHERN KHAIRUL ANAM P /BTK LAPORAN PRAKTIKUM GENETIKA MOLEKULAR HIBRIDISASI SOUTHERN KHAIRUL ANAM P051090031/BTK BIOTEKNOLOGI SEKOLAH PASCASARJANA INSTITUT PERTANIAN BOGOR 2009 0 HIBRIDISASI SOUTHERN PENDAHULUAN Hibridisasi Southern

Lebih terperinci

BAB III METODE PENELITIAN. Jenis penelitian yang digunakan adalah penelitian deskriptif.

BAB III METODE PENELITIAN. Jenis penelitian yang digunakan adalah penelitian deskriptif. 24 BAB III METODE PENELITIAN 3.1 Jenis Penelitian Jenis penelitian yang digunakan adalah penelitian deskriptif. 3.2 Objek Penelitian DNA ikan gurame (Osphronemus goramy Lac.) yang resisten dan sensitif

Lebih terperinci

Y ij = µ + B i + ε ij

Y ij = µ + B i + ε ij METODE Lokasi dan Waktu Penelitian ini dilaksanakan dari bulan September 2008 sampai bulan September 2009. Penelitian dilakukan di Laboratorium Mikrobiologi Bagian Teknologi Hasil Ternak Perah dan Laboratorium

Lebih terperinci

BAB III METODE PENELITIAN. Penelitian ini dilaksanakan dengan rancang bangun penelitian

BAB III METODE PENELITIAN. Penelitian ini dilaksanakan dengan rancang bangun penelitian BAB III METODE PENELITIAN 3.1 Rancangan Penelitian Penelitian ini dilaksanakan dengan rancang bangun penelitian eksperimental laboratorik. Proses ekstraksi dilakukan dengan menggunakan pelarut methanol

Lebih terperinci

Bab III Bahan dan Metode

Bab III Bahan dan Metode Bab III Bahan dan Metode A. Waktu dan Lokasi Penelitian Penelitian ini dilaksanakan pada bulan September 2012 di daerah budidaya rumput laut pada dua lokasi perairan Teluk Kupang yaitu di perairan Tablolong

Lebih terperinci

BAB III METODE PENELITIAN. D. Alat dan bahan Daftar alat dan bahan yang digunakan dalam penelitian ini dapat dilihat pada Lampiran 2.

BAB III METODE PENELITIAN. D. Alat dan bahan Daftar alat dan bahan yang digunakan dalam penelitian ini dapat dilihat pada Lampiran 2. BAB III METODE PENELITIAN A. Jenis penelitian Jenis penelitian yang dilakukan adalah penelitian dasar dengan menggunakan metode deskriptif (Nazir, 1998). B. Populasi dan sampel Populasi yang digunakan

Lebih terperinci

METODE PENELITIAN Waktu dan Tempat Penelitian Bahan dan Alat

METODE PENELITIAN Waktu dan Tempat Penelitian Bahan dan Alat 21 METODE PENELITIAN Waktu dan Tempat Penelitian Penelitian dilaksanakan selama 6 bulan, mulai Maret sampai dengan Agustus 2010 di laboratorium Mikrobiologi Medis, laboratorium Terpadu unit pelayanan mikrobiologi

Lebih terperinci

Teknik Isolasi Bakteri

Teknik Isolasi Bakteri MODUL 3 Teknik Isolasi Bakteri POKOK BAHASAN : 1. Pengenceran Suspensi Bakteri dari Sumber Isolat/Lingkungan 2. Teknik Isolasi Bakteri (Solid and Liquid Medium) TUJUAN PRAKTIKUM : 1. Memahami persiapan

Lebih terperinci

1 atm selama 15 menit

1 atm selama 15 menit 85 Lampiran 1. Prosedur Kerja L.1.1 Pembuatan Media Nutrient Agar Media Nutrient Agar - ditimbang sebanyak 20 gram dan dimasukkan dalam erlenmeyer 1000 ml - dilarutkandengan aquades 1000 ml - dipanaskan

Lebih terperinci

3 Metodologi Penelitian

3 Metodologi Penelitian 3 Metodologi Penelitian 3.1 Alat Peralatan yang digunakan dalam tahapan sintesis ligan meliputi laboratory set dengan labu leher tiga, thermolyne sebagai pemanas, dan neraca analitis untuk penimbangan

Lebih terperinci

METODE PENELITIAN. Penelitian ini dilaksanakan dari bulan Oktober sampai Februari 2014, dengan

METODE PENELITIAN. Penelitian ini dilaksanakan dari bulan Oktober sampai Februari 2014, dengan III. METODE PENELITIAN A. Tempat dan Waktu Penelitian ini dilaksanakan dari bulan Oktober sampai Februari 2014, dengan tahapan kegiatan, yaitu : bahan baku berupa singkong yang dijadikan bubur singkong,

Lebih terperinci

BAB 4 METODOLOGI PENELITIAN. 4.1 Jenis Penelitian Penelitian ini merupakan penelitian eksperimental laboratorik.

BAB 4 METODOLOGI PENELITIAN. 4.1 Jenis Penelitian Penelitian ini merupakan penelitian eksperimental laboratorik. BAB 4 METODOLOGI PENELITIAN 4.1 Jenis Penelitian Penelitian ini merupakan penelitian eksperimental laboratorik. 4.2 Waktu Penelitian Oktober - November 2008. 4.3 Lokasi Penelitian Laboratorium Biologi

Lebih terperinci

DAFTAR ISI DAFTAR TABEL... DAFTAR GAMBAR... DAFTAR LAMPIRAN...

DAFTAR ISI DAFTAR TABEL... DAFTAR GAMBAR... DAFTAR LAMPIRAN... DAFTAR ISI Bab Halaman DAFTAR TABEL... DAFTAR GAMBAR... DAFTAR LAMPIRAN... ix x xii I II III PENDAHULUAN 1.1 Latar Belakang... 1 1.2 Identifikasi Masalah... 2 1.3 Tujuan Penelitian... 2 1.4 Kegunaan Penelitian...

Lebih terperinci

ANALISIS PROTEIN SPESIFIK TEMBAKAU SRINTHIL. Disusun oleh : Nama : Slamet Haryono NIM :

ANALISIS PROTEIN SPESIFIK TEMBAKAU SRINTHIL. Disusun oleh : Nama : Slamet Haryono NIM : ANALISIS PROTEIN SPESIFIK TEMBAKAU SRINTHIL Disusun oleh : Nama : Slamet Haryono NIM : 412000011 FAKULTAS BIOLOGI UNIVERSITAS KRISTEN SATYA WACANA SALATIGA 2004 1. PENDAHULUAN Tembakau srinthil merupakan

Lebih terperinci

K. Ratnayani, Sagung Chandra Yowani, dan Liangky Syane S. Jurusan Kimia FMIPA Universitas Udayana, Bukit Jimbaran ABSTRAK

K. Ratnayani, Sagung Chandra Yowani, dan Liangky Syane S. Jurusan Kimia FMIPA Universitas Udayana, Bukit Jimbaran ABSTRAK AMPLIFIKASI FRAGMEN 0,4 KB DAERAH D-LOOP DNA MITOKONDRIA LIMA INDIVIDU SUKU BALI TANPA HUBUNGAN KEKERABATAN DENGAN METODE POLYMERASE CHAIN REACTION (PCR) K. Ratnayani, Sagung Chandra Yowani, dan Liangky

Lebih terperinci

III. METODE PENELITIAN. Penelitian dilaksanakan pada Desember 2014 Mei 2015 di. Laboratorium Mikrobiologi FMIPA Universitas Lampung.

III. METODE PENELITIAN. Penelitian dilaksanakan pada Desember 2014 Mei 2015 di. Laboratorium Mikrobiologi FMIPA Universitas Lampung. 19 III. METODE PENELITIAN 3.1. Waktu dan Tempat Penelitian Penelitian dilaksanakan pada Desember 2014 Mei 2015 di Laboratorium Mikrobiologi FMIPA Universitas Lampung. 3.2. Alat dan Bahan Alat yang digunakan

Lebih terperinci

Teknik Isolasi Bakteri

Teknik Isolasi Bakteri MODUL 3 Teknik Isolasi Bakteri POKOK BAHASAN : 1. Pengenceran Suspensi Bakteri dari Sumber Isolat/Lingkungan 2. Teknik Isolasi Bakteri TUJUAN PRAKTIKUM : 1. Memahami persiapan dan pelaksanaan pengenceran

Lebih terperinci

III. METODE PENELITIAN. dilaksanakan pada bulan Maret Mei Penelitian dilaksanakan di

III. METODE PENELITIAN. dilaksanakan pada bulan Maret Mei Penelitian dilaksanakan di III. METODE PENELITIAN 3.1 Waktu dan Tempat Penelitian mengenai identifikasi bakteri patogen pada ikan badut dilaksanakan pada bulan Maret Mei 2013. Penelitian dilaksanakan di Laboratorium Budidaya Perikanan

Lebih terperinci

LAPORAN PRAKTIKUM ISOLASI DNA, TEKNIK PCR, DAN ELEKTROFORESIS AGAROSE NAMA PRAKTIKAN : KARIN TIKA FITRIA ( )

LAPORAN PRAKTIKUM ISOLASI DNA, TEKNIK PCR, DAN ELEKTROFORESIS AGAROSE NAMA PRAKTIKAN : KARIN TIKA FITRIA ( ) LAPORAN PRAKTIKUM ISOLASI DNA, TEKNIK PCR, DAN ELEKTROFORESIS AGAROSE NAMA PRAKTIKAN : KARIN TIKA FITRIA (157008003) HARI/ TANGGAL PRAKTIKUM : RAHMIWITA (157008005) 1. ISOLASI DNA DARI DARAH : KAMIS/ 28

Lebih terperinci

BAB in. METODE PENELITIAN

BAB in. METODE PENELITIAN BAB in. METODE PENELITIAN Waktu Dan Tempat Penelitian Penelitian ini telah dilakukan dari April sampai November 2009 di laboratorium Biologi Molekular dan Rekayasa Genetika, Balai Penelitian Bioteknologi

Lebih terperinci

BAHAN DAN METODE Bahan dan Alat

BAHAN DAN METODE Bahan dan Alat 19 Metode ekstraksi tergantung pada polaritas senyawa yang diekstrak. Suatu senyawa menunjukkan kelarutan yang berbeda-beda dalam pelarut yang berbeda. Hal-hal yang harus diperhatikan dalam pemilihan pelarut

Lebih terperinci