BAB VII PENGEMBANGAN MARKA SNAP BERBASIS RESISTANCE GENE ANALOGUE

Save this PDF as:
 WORD  PNG  TXT  JPG

Ukuran: px
Mulai penontonan dengan halaman:

Download "BAB VII PENGEMBANGAN MARKA SNAP BERBASIS RESISTANCE GENE ANALOGUE"

Transkripsi

1 BAB VII PENGEMBANGAN MARKA SNAP BERBASIS RESISTANCE GENE ANALOGUE (RGA) DAN DEFENSE GENE ANALOGUE (DGA) UNTUK KETAHANAN TERHADAP LAYU FUSARIUM PADA TANAMAN PISANG (Musa spp.) Abstrak Pengembangan kultivar pisang tahan penyakit secara konvensional menghadapi kendala lamanya waktu yang diperlukan untuk seleksi dan evaluasi tanaman hasil persilangan, oleh karena itu pendekatan bioteknologi melalui pengembangan marka molekuler merupakan salah metode alternatif yang dapat digunakan. Berdasarkan substitusi basa nukleotida (SNP) yang diidentifikasi pada fragmen resistance gene analogue (RGA), β-1,3-glucanase dan chitinase asal tanaman pisang, dikembangkan marka SNAP untuk seleksi ketahanan tanaman pisang terhadap penyakit. Tahapan penelitian meliputi (1) penentuan situs SNP asal gen MNBS, β-1,3-glucanase dan chitinase untuk pembuatan primer SNAP, (2) pembuatan primer spesifik alel, (3) pengujian efektifitas primer SNAP dalam mengamplifikasi produk PCR pada DNA genom pisang, (4) pengujian dan pemilihan primer SNAP untuk marka ketahanan terhadap FOC pada 10 kultivar referensi dan beberapa kultivar/aksesi pisang lainnya. Primer SNAP dibuat berdasarkan 14 sekuen MNBS, 4 sekuen β-1,3-glucanase dan 8 sekuen chitinase. Berdasarkan fragmen gen MNBS dihasilkan sebanyak 14 pasang primer SNAP dan 10 diantaranya terbukti efektif mengamplifikasi produk PCR pada kultivar Klutuk Wulung dan Barangan, sedangkan dari fragmen gen β-1,3-glucanase diperoleh 6 pasang primer dan 22 pasang primer dihasilkan dari fragmen gen chitinase. Semua pasangan primer asal fragmen gen β-1,3-glucanase dan chitinase telah terbukti efektif mengamplifikasi produk PCR. Berdasarkan hasil pengujian menggunakan kultivar referensi terpilih 2 pasang primer berdasarkan fragmen gen MNBS, 2 pasang primer berdasarkan fragmen gen β-1,3-glucanase dan 10 pasang primer berdasarkan fragmen gen chitinase, yang digunakan sebagai marka SNAP untuk ketahanan terhadap layu FOC. Marka SNAP tersebut berhasil mengelompokkan kultivar pisang berdasarkan karakter ketahanan terhadap FOC. Hasil penelitian ini merupakan langkah awal dalam pembuatan marka SNAP berdasarkan gen yang bertanggung jawab pada ketahanan dan pertahanan terhadap penyakit tanaman pisang. Kata kunci: Pisang, SNAP, marka molekuler, RGA, DGA, ketahanan penyakit 1 Bagian bab ini telah diterbitkan di Jurnal Hortikultura Vol. 23 No. 4 dengan judul: Pengembangan Marka SNAP Berbasis Resistance Geneanalogue (RGA) pada Tanaman Pisang (Musa spp.)

2 106 THE DEVELOPMENT OF SNAP MARKER FOR FUSARIUM WILT RESISTANCE BASED ON RESISTANCE GENE ANALOGUE (RGA) AND DEFENSE GENE ANALOGUE (DGA) ON BANANA (Musa spp.) Abstract The development of resistance banana cultivars through conventional breeding methods encounters some obstacles, because breeding program require a long time for selecting and evaluating of the new hybrids. Therefore, the support of biotechnology approaches and molecular markers in banana breeding will be beneficial. SNAP markers for banana disease resistance were developed based on SNPs identified from RGAs, β-1,3-glucanase dan chitinase genes isolated from banana. The activities include (1) the identification of putative SNPs from RGAs, β-1,3-glucanase dan chitinase genes for generating of SNAP primers, (2) allel specific primer design, (3) the evaluation of effectivity of primers on PCR reactions, (4) selection and evaluation of SNAP primers for FOC resistance marker using 12 banana cultivars. SNAP primers were generated based on 14 MNBS, 4 β-1,3-glucanase dan 8 chitinase sequences. Fourteen allelic specific primers were obtained from MNBS sequences and 10 of them were able to amplified PCR products from genomic DNA of banana cv. Klutuk Wulung and Barangan. Six allelic primers from β-1,3-glucanase gene and 22 primers from chitinase gene were effectively able to amplified PCR products from genomic DNA of the same banana cultivars. Two primers pairs based on MNBS sequences, 2 primers based on β-1,3-glucanase gene sequences, and 10 primers based on chitinase gene sequences were selected for SNAP marker for FOC resistance. This study was the initial effort of SNAP marker development using RGAs and defense genes and potentially can be used for banana disease resistance markers in general. Keywords: Banana, SNAP, molecular marker, RGA, DGA, disease resistance 1 Part of this chapter has been published in the Jurnal Hortikultura Vol. 23 No. 4, entitled: Pengembangan Marka SNAP Berbasis Resistance Gene Analogue (RGA) pada Tanaman Pisang (Musa spp.)

3 107 Pendahuluan Marka molekuler seperti RAPD (Howell et al.1994), RFLP (Faure et al. 1993), SSR (Crouch et al. 1998), ISSR (Venkatachalam et al. 2008) dan AFLP (Ude et al. 2002) telah digunakan sebagai alat untuk analisis genetik tanaman pisang. Marka RAPD dan SCAR telah digunakan sebagai indikator seleksi secara tidak langsung untuk ketahanan pisang terhadap penyakit bercak daun sigatoka (Nwauzoma et al. 2011) dan layu Fusarium (Wang et al. 2012). Single nucleotide polymorphism (SNP) adalah marka molekular generasi baru yang telah dikembangkan dan digunakan pada kedokteran, ternak dan tanaman (Gupta et al. 2001). Marka molekuler berbasis SNP telah mulai banyak digunakan untuk studi genotipe (Till et al. 2010), pembuatan peta tautan genetik beresolusi tinggi (Drenkard et al. 2000; Rabbi et al. 2012), identifikasi varietas ginseng (Sun et al. 2011), penentuan spesies dari kerabat jeruk (Jiang et al. 2010), identifikasi Canabis yang menghasilkan produk narkotika atau tidak (Rotherham & Harbison 2011), dan seleksi untuk karakter tertentu (MAS) dalam proses pemuliaan tanaman (Gupta et al. 2001). Metode identifikasi SNP yang masih sering digunakan untuk skala kecil adalah Cleaved Amplified Polymorphic Sequence (CAPS), derived CAPS (dcaps) (Thiel et al. 2004; Nasu et al. 2002) dan Allel Specific-PCR (AS-PCR) atau Single Nucleotide Amplified Polymorphism (SNAP) (Drenkard et al. 2000; Liu et al. 2012). Dalam aplikasinya marka CAPS dan dcaps mempunyai keterbatasan yaitu memerlukan enzim nuclease sehingga memerlukan biaya yang masih relatif tinggi, sedangkan marka AS-PCR atau SNAP hanya memerlukan pasangan primer dan teknik PCR dan elektroforesis gel agarose standar (Drenkard et al. 2000). Salah satu contoh pengembangan marka SNAP untuk marka yang berhubungan dengan karakter aroma dan supernodulasi pada tanaman kedelai (Kim et al. 2005; Juwattanasomran et al. 2011), sehingga proses seleksi yang berhubungan dengan kedua karakter tersebut bisa lebih cepat dan efisien. Secara umum penelitian yang dilakukan berusaha mengembangkan marka SNAP untuk seleksi tidak langsung sifat ketahanan tanaman pisang terhadap penyakit. Secara khusus penelitian yang dilakukan bertujuan untuk: (1) menentukan situs SNP non synonymous pada RGA dan DGA asal tanaman pisang untuk pengembangan marka SNAP, (2) mendisain pasangan primer spesifik alel untuk menghasilkan marka SNAP pada situs-situs SNP yang teridentifikasi, (3) mengevaluasi efektivitas pasangan primer yang didapat untuk menghasilkan marka SNAP, dan (4) mengevaluasi marka SNAP berasis RGA dan DGA sebagai marka ketahanan terhadap FOC pada beberapa kultivar pisang. Bahan dan Metode Waktu dan Tempat Kegiatan penelitian dilaksanakan mulai bulan November 2012 sampai Juli 2013, di laboratorium Pemuliaan dan Biologi Molekular Tanaman, Program Studi Agronomi dan Hortikultura, Fakultas Pertanian, Institut Pertanian Bogor.

4 108 Bahan Penelitian dan Isolasi DNA Pengujian efektivitas primer SNAP dilakukan menggunakan DNA genom yang diisolasi dari daun pisang cv. Klutuk Wulung (BB) dan Barangan (AAA). Penentuan primer SNAP untuk marka ketahanan terhadap penyakit layu FOC, digunakan DNA genom asal kultivar pisang yang mempunyai ketahanan terhadap FOC yang bervariasi sebagai kultivar referensi. Sebagian kultivar yang digunakan sebagai referensi adalah kultivar yang telah diuji ketahanannya terhadap penyakit layu FOC pada Percobaan 1, dan sebagian lagi berdasarkan informasi hasil penelitian sebelumnya (Molina et al. 2010). Untuk tanaman sangat rentan sampai rentan digunakan kultivar Barangan, Ambon Kuning dan Ambon Hijau. Kultivar yang mewakili rentan sampai tahan adalah Ketan, Kepok, Jawaka dan Awak, sedangkan yang mewakili kultivar tahan sampai sangat tahan adalah Calcuta, Rejang dan Klutuk Wulung. Pengujian marka SNAP selanjutnya dilakukan pada 10 kultivar/aksesi yang belum diketahui ketahanannya, yang mewakili spesies liar M. acuminata: HlbS, Slk-29 dan yang kultivar, yaitu: MDO-01, MDO-04, MLU-07, SUM-01, SUM-04, HyKC-01 dan Muli, serta seksi Australimusa AMB-01. Bahan tanaman yang digunakan adalah daun muda dan isolasi DNA berdasarkan metode CTAB (Doyle & Doyle 1987) yang dimodifikasi oleh Das et al. (2009). Selanjutnya stok DNA disimpan dalam lemari pendingin bersuhu -20 C sampai siap digunakan. Identifikasi Situs SNP yang Non-synonymous Diantara sejumlah situs SNP yang teridentifikasi, dipilih situs SNP pada coding region yang menyebabkan terjadinya perubahan residu asam amino atau disebut non-synonymous. Identifikasi situs SNP yang nonsynonymous berbasis RGA dilakukan pada sekuen DNA dari 14 fragmen RGA asal tanaman pisang (MNBS) yang telah diisolasi dari Percobaan 2, sedangkan SNP berbasis DGA dilakukan pada sekuen chitinase hasil dari Percobaan 3, dan sekuen β-1,3-glucanase hasil dari Percobaan 4. Identifikasi situs SNP dengan melakukan pensejajaran sekuen DNA dan prediksi asam amino dari menggunakan perangkat lunak Geneious Pro versi percobaan (Biomatters, USA). Disain Primer Spesifik Alel untuk Marka SNAP Pasangan primer SNAP didisain berdasarkan situs SNP terpilih dengan menggunakan perangkat lunak WebSNAPER yang tersedia di situs Ketika mengakses situs tersebut, pada layar WebSNAPER dipilih menu SNAP Program. Pengguna program yang baru pertama kali mengakses harus melakukan Sign in dan memasukkan alamat pengguna pada tempat yang tersedia. Setelah Sign in, muncul kotak dialog (Gambar 1) untuk memasukkan runutan nukleotida dengan situs SNP target yang dievaluasi. Situs SNP target ditandai sebagai [X/Y], dimana X adalah nukleotida untuk alel referensi dan Y adalah nukleotida untuk alel alternatif. Beberapa parameter yang perlu diisi/disesuaikan adalah ukuran produk amplifikasi PCR, suhu TM dan nama primer yang diinginkan. Screen shot perangkat lunak WebSNAPER dan sejumlah isian yang perlu diisi terkait dengan disain marker SNAP disajikan pada Gambar 33.

5 109 Gambar 33 Tampilan perangkat lunak WebSNAPER yang digunakan untuk mendisain primer SNAP. Runutan nukleotida yang diberi lingkaran adalah posisi single nucleotide polymorphism (SNP) yang digunakan. Setelah semua parameter terisi (Gambar 33), perangkat lunak diaktifkan dengan menekan tombol Submit!. Perangkat lunak WebSNAPER mengirimkan hasil analisisnya dalam bentuk pesan elektronik ke alamat pengguna, yang selanjutnya dapat dikonversi dan dibaca dengan menggunakan perangkat lunak pengolah kata. Proses disain primer tersebut diulang kembali untuk setiap posisi SNP pada runutan DNA yang diinginkan. Selanjutnya dari masing-masing hasil analisis untuk setiap situs SNP akan dipilih satu set (4) primer yang terdiri atas sepasang primer untuk alel referensi dan sepasang primer yang lain untuk alel alternatif. Setelah runutan primer diperoleh dan dipilih sesuai dengan jumlah situs SNP, primer disintesis dengan menggunakan perusahaan jasa pembuatan primer. Evaluasi Efektivitas Primer SNAP Untuk menentukan posisi SNP mana saja yang dapat digunakan untuk menghasilkan marka SNAP, setelah disain primer dan pemesanan primer diselesaikan, primer SNAP yang didapat diuji kemampuannya untuk menghasilkan produk amplifikasi dengan menggunakan cetakan DNA genom pisang. Dalam penelitian ini, pengujian efektivitas primer SNAP dilakukan dengan menggunakan DNA genom pisang cv. Klutuk Wulung dan Barangan. Reaksi PCR dilaksanakan dengan volume 25 µl menggunakan KAPA2G TM PCR Kit (Kapa Biosystems Inc., USA), yang komposisinya terdiri atas 5.0 µl 5 X buffer PCR (di dalamnya terkandung 1.5 mm Mg 2+ ), 0.5 µl MgCl 2 25 mm, 0.5 µl dntps 10 mm, 1.0 µl masing-masing primer dengan konsentrasi 10 µm (primer forward dan reverse), 30 ng DNA genom, 0.1 µl Taq DNA polymerase (5 U µl -1 ) dan 15.4 µl ddh 2 O. Proses PCR menggunakan mesin GeneAmp PCR System

6 (Perkin Elmer). Denaturasi cetakan DNA pada awal reaksi pada suhu 95 C selama 3 menit, diikuti dengan 35 kali siklus 95 C selama 10 detik, 60 sampai 62 C selama 10 detik dan 72 C selama 3 detik, dan diakhiri dengan satu siklus 72 C selama 10 menit. Produk PCR dipisahkan berdasarkan ukuran dengan menggunakan elektroforesis gel agarose 1 % pada mesin elektroforesis dengan tegangan 80 V selama 25 menit. Analisis Data Berdasarkan hasil elektroferogram, data keberadaan pita amplifikasi dikonversi menjadi data binary untuk membuat data genotipe. Bila dalam satu lokus hanya primer reference yang menghasilkan produk amplifikasi, disandi dengan , bila hanya primer alternate yang menghasilkan produk, disandi dengan , sedangkan bila kedua primer menghasilkan produk disandi dengan Selanjutnya dari data genotipe yang diperoleh, dilakukan analisis filogenetik menggunakan perangkat lunak NTSYS ver 2.02 (Exeter Software, New York, USA). Hasil dan Pembahasan Single nucleotide polymorphism (SNP) adalah polimorfisme yang disebabkan oleh proses substitusi satu basa pada nukleotida dalam genom tanaman (Syvänen 2001). Keberadaan SNP diketahui menyebar di seluruh bagian dari genom tanaman sehingga berpotensi untuk digunakan sebagai marka molekuler (Gupta et al. 2001). Identifikasi Situs SNP yang Non-synonymous SNP berbasis sekuen RGA. Fragmen MNBS yang digunakan dalam penelitian ini berukuran 524 pasang basa (pb). Seluruh runutan nukleotida MNBS tersebut merupakan bagian exon dan tidak terdapat intron di dalamnya. Fragmen MNBS menyandi 174 asam amino yang merupakan bagian dari domain motif p-loop sampai dengan GLPL. Berdasarkan hasil pensejajaran runutan DNA diantara 14 MNBS, berhasil diidentifikasi keberadaan 30 situs SNP. Nukleotida pada urutan nomor 215 merupakan situs SNP dengan varian nukleotida [G/A]. Pada posisi tersebut, keberadaan SNP menyebabkan terjadinya substitusi residu asam amino dari arginin (R) menjadi lisin (K) (Gambar 34). Situs SNP seperti pada posisi 215 yang dipilih untuk pengembangan marka SNAP dalam tahap-tahap penelitian selanjutnya. Dari 30 situs SNP yang berhasil diidentifikasi pada fragmen MNBS, diperoleh 20 situs SNP yang menyebabkan terjadinya substitusi asam amino. Selanjutnya, 20 situs SNP tersebut dipilih untuk mendisain pasangan primer SNAP. Meskipun tergolong menyebabkan substitusi residu asam amino, belum tentu dari setiap situs SNP yang terpilih dapat didisain pasangan primer SNAP, karena tidak semua situs bisa menghasilkan pasangan primer. Kegagalan mendisain primer dari situs yang teridentifikasi antara lain disebabkan oleh kurangnya jumlah basa di sekitar situs SNP terutama untuk situs SNP ada di ujung 5 ataupun 3 runutan nukleotida fragmen DNA yang digunakan atau karena komposisi nukleotida di sekitar target SNP tidak dapat memenuhi kriteria yang ditentukan di awal proses disain primer.

7 NT AA Gambar 34 Representasi situs SNP pada fragmen MNBS asal pisang (Musa spp.). Situs SNP 195 dan 225 tidak menyebabkan terjadinya substitusi asam amino sedangkan situs SNP 215 merubah residu asam amino arginin menjadi lisin. NT: runutan nukleotida DNA dan AA: runutan asam amino yang diprediksi dari runutan NT, segitiga merah: posisi SNP. Gambar 35 Representasi situs SNP pada fragmen MNBS. Situs SNP dengan latar belakang kuning adalah situs SNP yang menyebabkan terjadinya substitusi asam amino sedangkan situs SNP di dalam kotak merah adalah situs SNP terpilih untuk pembuatan primer SNAP. Nomor di atas runutan DNA mengindikasikan posisi nukleotida dalam fragmen MNBS. EU dan EU adalah RGA asal Musa yang terdeposit dalam GenBank NCBI. Untuk mendisain primer, di sekitar situs SNP disyaratkan keberadaan sebanyak minimal 25 nukleotida. Selain itu untuk mengkonfirmasi apakah situs SNP teridentifikasi benar-benar SNP atau kesalahan proses sekuensing (sequencing error), dalam pemilihan SNP perlu dilibatkan juga aksesi dari gen serupa yang diambil dari GenBank. Untuk mendisain primer spesifik alel, dari alternatif 20 situs SNP pada

8 112 fragmen MNBS, hanya 8 situs SNP saja yang dipilih (Gambar 35). SNP berbasis sekuen β-1,3-glucanase. Analisis pensejajaran 4 sekuen MaGlu yang berukuran 788 pb yang diperoleh dalam penelitian ini menemukan adanya 8 SNP, tetapi hanya 4 SNP yang menyebabkan perubahan asam amino atau non-synonymous SNP, yaitu nukleotida pada urutan nomor 91, 538, 677 dan 778. Keberadaan situs SNP ditampilkan pada Gambar 36. SNP berbasis sekuen gen chitinase. Berdasarkan analisis pensejajaran 8 sekuen gen MaChi yang berukuran 596 pb yang diperoleh dalam penelitian ini ditemukan sebanyak 22 situs SNP pada coding region dan 6 situs SNP pada noncoding region. Namun demikian hanya 14 situs SNP yang menyebabkan substitusi 11 residu asam amino (Gambar 37), dan 11 situs di antaranya digunakan untuk mendisain primer SNAP. [G/C] [A/C] [A/G] [C/A] MaGlu_Klt : MaGlu_Rjg: MaGlu_AH : MaGlu_Br : NT AA Gambar 36 Keberadaan situs SNP pada fragmen MaGlu asal pisang (Musa spp.). Situs SNP 30, 480, 618 dan 753 tidak menyebabkan terjadinya substitusi residu asam amino sedangkan situs SNP 91, 538, 677 dan 778 yang dapat merubah residu asam amino (segitiga merah). NT: runutan nukleotida DNA dan AA: runutan asam amino yang diprediksi dari runutan NT. Huruf di atas segitiga merah adalah varian nukleotida pada situs non-synonymous SNP. Gambar 37 Representasi situs SNP pada fragmen gen MaChi dari 5 kultivar pisang. MaChi-Rjg asal Rejang, MaChi_Klt#1 & #2 asal Klutuk Wulung, MaChi_Kpk#1 & #2 asal Kepok, MaChi_AH#1 & #2 asal Ambon Hijau, dan MaChi_Br asal Barangan. Tanda bintang di bawah sekuen adalah posisi SNP, dan angka di atas sekuen adalah posisi basa nukleotida dalam fragmen MaChi asal DNA genom. Basa nukleotida dalam kotak adalah SNP yang digunakan untuk mengembangkan marka SNAP.

9 Tabel 22 Primer alternatif sebagai luaran yang didapat dari proses mendisain primer dengan menggunakan WebSNAPER untuk situs SNP1 dari fragmen gen MNBS Identitas primer Runutan nukleotida Tm ( C) Panjang (pb ) Produk PCR (pb) Catatan peringatan SNP1_MNBS_L_REF_1 CCGCGATTA ACCATGTGGTGCTCA SNP1_MNBS_L_REF_1_REV GCAGGGCA ATCTCCATGGGCTC SNP1_MNBS_L_REF_2 CCCGCGATT TTACCATGTGGTGTTCA SNP1_MNBS_L_REF_2_REV GCAGGGCA ATCTCCATGGGCTC SNP1_MNBS_L_REF_3 CCCGCGATT TTACCATGTGGTGAACA SNP1_MNBS_L_REF_3_REV GCAGGGCA ATCTCCATGGGCTC SNP1_MNBS_L_REF_4 CCGCGATTA ACCATGTGGTGGTCA SNP1_MNBS_L_REF_4_REV GCAGGGCA ATCTCCATGGGCTC SNP1_MNBS_L_REF_5 CCGCGATTA ACCATGTGGTGAGCA SNP1_MNBS_L_REF_5_REV GCAGGGCA ATCTCCATGGGCTC SNP1_MNBS_L_ALT_1 * CCGCGATTA ACCATGTGGTGATGC High end self SNP1_MNBS_L_ALT_1_REV GCAGGGCA ATCTCCATGGGCTC complementarity SNP1_MNBS_L_ALT_2 * CCGCGATTA ACCATGTGGTGAACC High end self SNP1_MNBS_L_ALT_2_REV GCAGGGCA ATCTCCATGGGCTC complementarity SNP1_MNBS_L_ALT_3 CCGCGATTA ACCATGTGGTGAGCC SNP1_MNBS_L_ALT_3_REV GCAGGGCA ATCTCCATGGGCTC SNP1_MNBS_L_ALT_4 CCGCGATTA ACCATGTGGTGACCC SNP1_MNBS_L_ALT_4_REV GCAGGGCA ATCTCCATGGGCTC SNP1_MNBS_L_ALT_5 CCGCGATTA ACCATGTGGTGTTCC SNP1_MNBS_L_ALT_5_REV GCAGGGCA ATCTCCATGGGCTC SNP1_MNBS_L_ALT_6 CCGCGATTA ACCATGTGGTGGTCC SNP1_MNBS_L_ALT_6_REV GCAGGGCA ATCTCCATGGGCTC SNP1_MNBS_L_ALT_7 CCGCGATTA ACCATGTGGTGCTCC SNP1_MNBS_L_ALT_7_REV GCAGGGCA ATCTCCATGGGCTC Keterangan: nukleotida yang diberi garis bawah padaa primer forward adalah mismatch. Primer yang yang diberi tanda asterik [*] tidak dipilih untuk menghasilkan marka SNAP karena high end self complementarity

10 114 Disain Primer untuk Marka SNAP Pada Tabel 22 disajikan contoh luaran dari tahapan disain primer SNAP menggunakan perangkat lunak WebSNAPER. Contoh luaran hasil analisis situs SNP posisi #1 tersebut telah dikonversi ke dalam bentuk tabel. Dalam disain primer SNAP dengan menggunakan WebSNAPER, dari satu situs SNP dapat diperoleh sejumlah alternatif pasangan primer untuk menghasilkan marka SNAP. Sebagai contoh, untuk SNP yang dievaluasi posisi #1 telah dihasilkan 12 pilihan pasangan primer SNAP (5 pasang primer reference dan 7 pasang primer alternate) seperti yang ditampilkan pada Tabel 22. Namun demikian 2 primer alternate tidak bisa dipilih karena berpotensi membentuk utas ganda antar pasangan primer (high end self complementarity), yaitu pasangan primer SNP1_MNBS_L_ALT_1 dan SNP1_MNBS_L_ALT_2. Selanjutnya dari 12 alternatif primer yang dihasilkan, hanya akan dipilih sepasang primer untuk alel referensi dan sepasang primer untuk alel alternatif. Salah satu hal penting dalam pemilihan primer SNAP adalah Tm. Pasangan primer harus mempunyai Tm yang tidak jauh berbeda. Pada Tabel 22 terlihat bahwa terdapat satu nukleotida yang berbeda selain pada situs SNP-nya (ujung 3 ) dari primer forward terhadap sekuen aslinya, yang disebut mismatch. Posisi mismatch bisa berjarak satu sampai 4 nukleotida dari situs SNP. Untuk lebih jelasnya bisa dilihat pada Gambar 38 yang menunjukkan pensejajaran runutan nukleotida semua primer forward dari Tabel 22 dengan fragmen aslinya (MNBS). Menurut Bru et al. (2008), posisi mismatch dari ujung 3 sangat berpengaruh terhadap keberhasilan mendapatkan produk PCR. Semakin dekat mismatch dengan ujung 3 semakin besar kegagalan mendapat produk PCR. Berdasarkan hal tersebut, maka primer SNAP yang dipilih adalah yang mempunyai posisi mismatch dengan jarak paling jauh dari ujung. Gambar 38 adalah contoh pensejajaran runutan nukleotida primer forward untuk SNP1 dari Tabel 22 terhadap fragmen MNBS untuk melihat jarak nukleotida mismatch terhadap ujung 3 (situs SNP1). Berdasarkan hasil disain primer SNAP, dari 8 situs SNP fragmen MNBS yang dipilih, satu situs SNP (posisi #215) tidak menghasilkan primer SNAP karena primer yang didapat mempunyai peluang membentuk utas ganda dengan dirinya sendiri pada ujung-ujungnya (high end self complementarity). Hal ini dapat mengakibatkan terbentuknya hairpin atau terbentuknya primer dimer sehingga berpotensi mengganggu amplifikasi fragmen target dan produk PCR yang diinginkan tidak dapat dihasilkan (Brownie et al. 1997). Gambar 38 Pensejajaran runutan nukleotida dari alternatif primer untuk situs SNP#1 dengan fragmen MNBS. Tanda segitiga hitam adalah situs SNP#1 dan segitiga putih adalah posisi mismatch terjauh dari ujung 3 primer yang didapat.

11 Tabel 23 Primer SNAP terpilih dari 7 situs SNP asal fragmen gen MNBS yang dapat digunakan untuk menghasilkan marka SNAP SNP Identitas primer Sekuen primer forward (5-3 ) Sekuen primer reverse (5-3 ) Suhu TM (ºC) Produk (pb) 1 SNP1_MNBS_Ref CCGCGATTACCATGT TGGTGCTCA GCAGGGCATCTCCATGGGCTC SNP1_MNBS_Alt CCGCGATTACCATGT TGGTGCTCC GCAGGGCATCTCCATGGGCTC SNP2_MNBS_Ref GGCGAGGATCAGCTT TCCACCCTTT GGTGATCATGATCGAGGTTGCCAACT SNP2_MNBS_Alt GGCGAGGATCAGCTT TCCACCCTTA GGTGATCATGATCGAGGTTGCCAACT SNP3_MNBS_Ref GCGAGGCGAGGATCA AGATTC GGAATGGGGAAAACGACGCT SNP3_MNBS_Alt GCGAGGCGAGGATCA AGATTA GGAATGGGGAAAACGACGCT SNP4_MNBS_Ref TGGTTCGACCGCGAG GGCCAG GGAATGGGGAAAACGACGCTCCT SNP4_MNBS_Alt TGGTTCGACCGCGAG GGCCAC GGAATGGGGAAAACGACGCTCCT SNP5_MNBS_Ref AACCTCAGCGATTCA ATTGGCGC ATGCAGAAGATCATCGCCAATCGG SNP5_MNBS_Alt ACAACCTCAGCGATT TCATTGGCGT ATGCAGAAGATCATCGCCAATCGG SNP6_MNBS_Ref CGGAACAACCTCAGC CGATTCCTTG GGTGATCATGATCGAGGTTGCCAACT SNP6_MNBS_Alt CCGGAACAACCTCAG GCGATTCACTC GGTGATCATGATCGAGGTTGCCAACT SNP7_MNBS_Ref CTGTATGATATCCAT TGGCGGTTC ATGCAGAAGATCATCGCCAATC SNP7_MNBS_Alt TCTGTATGATATCCA ATGGCGGTTT ATGCAGAAGATCATCGCCAATC Keterangan: Nukleotida yang diberi garis bawah adalah mismatch Tabel 24 Primer SNAP terpilih dari 3 situs SNP asal fragmen gen β-1,3-glucanase yang dapat digunakan untuk menghasilkan marka SNAP SNP Identitas primer Sekuen primer forward (5-3 ) Sekuen primer reverse (5-3 ) Suhu TM (ºC) Produk (pb) 1 SNP1_MGlu_Ref GGATGTCCCCCGATCCGTCG TTACTCGCCAAGAACTGCACGATGG SNP1_MGlu_Alt GGATGTCCCCCGATCCGTCC TTACTCGCCAAGAACTGCACGATGG SNP2_MGlu_Ref CGATGGCGTCGAACAGGTGCTT TACATCCTCCCCGCCATGCG SNP2_MGlu_Alt GACGATGGCGTCGAACAGGTTTTG TACATCCTCCCCGCCATGCG SNP3_MGlu_Ref GCCTGATCAAGTTCTGGTTGTACGCCT GCCCAGGCGTACCTGAGCCC SNP3_MGlu_Alt CCTGATCAAGTTCTGGTTGTACGGCC GCCCAGGCGTACCTGAGCCC Keterangan: Nukleotida yang diberi garis bawah adalah mismatch

12 Tabel 25 Primer SNAP terpilih dari 11 situs SNP asal fragmen gen chitinase yang dapat digunakan untuk menghasilkan marka SNAP SNP Identitas primer Sekuen primer forward (5-3 ) Sekuen primer reverse (5-3 ) 1 SNP1_Mchi_Ref GCGTGGGGTTACTGCTTCGTCA GTGGTGACACCGTAGCCCGGAA SNP1_Mchi_Alt GCGTGGGGTTACTGCTTCGTCC GTGGTGACACCGTAGCCCGGAA 2 SNP2_Mchi_Ref CGCGTGGGGTTACTGCTTCATGAG GTGGTGACACCGTAGCCCGGAA SNP2_Mchi_Alt CGCGTGGGGTTACTGCTTCATGAC GTGGTGACACCGTAGCCCGGAA 3 SNP3_Mchi_Ref GCGTGGGGTTACTGCTTCATCGGT GTGGTGACACCGTAGCCCGGAA SNP3_Mchi_Alt CGTGGGGTTACTGCTTCATCGGG GTGGTGACACCGTAGCCCGGAA 4 SNP4_Mchi_Ref GGGGTTACTGCTTCATCAGTGCACG GTGGTGACACCGTAGCCCGGAA SNP4_Mchi_Alt TGGGGTTACTGCTTCATCAGTGCACA GTGGTGACACCGTAGCCCGGAA 5 SNP5_Mchi_Ref CTTCATCAGTGAACGGAACCGCC GTGGTGACACCGTAGCCCGGAA SNP5_Mchi_Alt GCTTCATCAGTGAACGGAACCGCT GTGGTGACACCGTAGCCCGGAA 6 SNP6_Mchi_Ref CATCAGTGAACGGAACCCCCAAAA GTGGTGACACCGTAGCCCGGAA SNP6_Mchi_Alt TCATCAGTGAACGGAACCCCCAAAC GTGGTGACACCGTAGCCCGGAA 7 SNP7_Mchi_Ref CCCAAAGGACTACTGCGTCGCAAA GTGGTGACACCGTAGCCCGGAA SNP7_Mchi_Alt CCCAAAGGACTACTGCGTCGCAAG GTGGTGACACCGTAGCCCGGAA 8 SNP8_Mchi_Ref GGTGGCCACCAGGTCTGGGATC CGGCTTTCTTGGCCCAGTTATCTCA SNP8_Mchi_Alt GTGGCCACCAGGTCTGGGATG CGGCTTTCTTGGCCCAGTTATCTCA 9 SNP9_Mchi_Ref CGACGGCTTGGGCGACTCAGT CGCGTGGGGTTACTGCTTCATCA SNP9_Mchi_Alt GACGGCTTGGGCGACTGTGG CGCGTGGGGTTACTGCTTCATCA 10 SNP10_Mchi_Ref CGGCGTTGGTTGGCTTTCAA TGCGCTGCAGGCAAGAAATACTACG SNP10_Mchi_Alt CGGCGTTGGTTGGCTTCGAC TGCGCTGCAGGCAAGAAATACTACG 11 SNP11_Mchi_Ref CCGGTCGGCGTTGGTTGTCT TGCGCTGCAGGCAAGAAATACTACG SNP11_Mchi_Alt CCGGTCGGCGTTGGTTGGTG TGCGCTGCAGGCAAGAAATACTACG Keterangan: Nukleotida yang diberi garis bawah adalah mismatch Suhu TM (ºC) Produk (pb)

13 117 Disain primer menggunakan 7 situs SNP menghasilkan total 64 alternatif primer SNAP. Untuk setiap situs SNP diperlukan 2 pasangan primer, yang terdiri atas sepasang primer forward dan reverse untuk alel referensi dan sepasang primer forward dan reverse untuk alel alternatifnya. Dengan demikian, dari 7 situs SNP pada fragmen gen MNBS, dihasilkan 14 pasang primer SNAP seperti yang ditampilkan pada Tabel 23. Cara yang sama dalam mendisain primer SNAP untuk fragmen gen MNBS juga diterapkan untuk mendisain primer SNAP fragmen gen β-1,3- glucanase (MaGlu) dan chitinase (MaChi). Di dalam fragmen gen β-1,3- glucanase (MaGlu) dari 4 situs SNP yang menyebabkan substitusi residu asam amino, hanya 3 situs yang dipilih untuk mendisain primer SNAP. Satu situs SNP yang berada pada urutan nukleotida nomor 778 tidak dapat digunakan untuk mendisain primer SNAP, karena letaknya terlalu dekat dengan ujung dari fragmen MaGlu (berjarak 9 basa nukleotida), sehingga tidak memenuhi kriteria untuk perancangan primer SNAP menggunakan WebSNAPER. Untuk mendisain primer, di sekitar situs SNP disyaratkan keberadaan sebanyak minimal 25 basa nukleotida. Berdasarkan 3 situs SNP yang digunakan untuk mendisain primer, diperoleh 22 alternatif pasangan primer SNAP. Berdasarkan beberapa kriteria dalam pemilihan primer seperti yang telah dijelaskan sebelumnya, dipilih 6 pasang primer SNAP untuk 3 situs SNP yang terdapat dalam fragmen MaGlu. Pasangan primer terpilih ditampilkan pada Tabel 24. Di dalam fragmen gen chitinase (MaChi), dari 14 situs SNP yang teridentifikasi dipilih 11 situs SNP yang digunakan untuk merancang primer SNAP. Disain primer menggunakan 11 situs SNP menghasilkan total 124 alternatif pasangan primer SNAP. Berdasarkan kriteria tertentu dalam pemilihan primer seperti yang dijelas sebelumnya pada perancangan primer SNAP untuk RGA, diperoleh 22 pasang primer untuk 11 situs SNP yang teridentifikasi pada fragmen gen chitinase, seperti yang ditampilkan pada Tabel 25. Evaluasi Efektivitas Primer SNAP untuk Menghasilkan Marka Kemampuan primer SNAP yang dikembangkan untuk menghasilkan marka SNAP dengan menggunakan genom tanaman pisang perlu dievaluasi. Untuk evaluasi primer dalam penelitian, dari 14 pasangan primer SNAP yang dihasilkan berdasarkan fragmen gen MNBS, ini hanya dievaluasi 10 pasang primer SNAP. Pada Gambar 39 disajikan hasil PCR yang dilakukan dengan menggunakan 10 pasang primer SNAP dan DNA genom pisang cv. Klutuk Wulung atau Barangan. Produk amplifikasi PCR difragmentasi menggunakan teknik elektroforesis gel agarose, di-staining dengan ethidium bromide (EtBr), dan divisualisasi di bawah penyinaran UV. Berdasarkan elektroferogram (Gambar 39), pasangan primer yang diuji mampu menghasilkan produk PCR. Semua pasangan primer yang diuji menghasilkan produk PCR pada kedua pisang Klutuk Wulung dan Barangan yang diuji. Untuk primer SNP6_MNBS_Alt, hasil PCR-nya negatif dan tidak ada produk PCR ketika diuji menggunakan genom pisang Barangan. Hal tersebut menunjukkan bahwa pada Klutuk Wulung 5 lokus SNP yang diuji mempunyai kombinasi alel heterozigot, sedangkan pada Barangan, 4 lokus SNP mempunyai kombinasi alel heterozigot dan satu lokus homozigot (lokus SNP6_MNBS).

14 118 SNP1_MNBS SNP2_MNBS SNP4_MNBS SNP5_MNBS SNP6_MNBS A. R A R A R A R A R A B. Gambar 39 Produk PCR hasil amplifikasi dari genom tanaman pisang cv. Klutuk Wulung (A) dan Barangan (B) menggunakan 10 pasang primer SNAP berdasarkan situs SNP pada gen MNBS. R= primer reference, A= primer alternate Produk PCR hasil amplifikasi menggunakan 6 pasang primer SNAP yang dihasilkan untuk fragmen gen MaGlu terhadap DNA genom kultivar Klutuk Wulung dan Barangan ditampilkan pada Gambar 40. Berdasarkan hasil PCR menggunakan DNA genom pisang kultivar Klutuk Wulung dan Barangan sebagai cetakan DNA, semua pasang primer (6 pasang) yang didisain berdasarkan 3 situs SNP dari fragmen MaGlu yang diperoleh dari penelitian ini, mampu menghasilkan produk PCR. Berdasarkan hasil elektroferogram (Gambar 40) terlihat pasangan primer SNP1_MGlu_Ref memberikan hasil negatif pada kultivar Klutuk Wulung, tetapi hasil positif pada kultivar Barangan. Hasil sebaliknya diperoleh apabila menggunakan pasangan primer SNP1_MGlu_Alt. Hal ini menunjukkan lokus SNP1_MGlu kedua kultivar tersebut mengandung alel homozigot, dan sesuai dengan situs SNP yang teridentifikasi pada masing-masing kultivar (Gambar 39). Primer SNP1_MGlu_Ref adalah primer yang mengamplifikasi fragmen MaGlu yang mengandung nukleotida G sebagai situs SNP1 pada nukleotida nomor 91, yang terdapat pada Barangan, sedangkan primer SNP1_MGlu_Alt mengamplifikasi fragmen yang mengandung nukleotida C (nukleotida nomor 91) pada Klutuk Wulung. Semua pasangan primer SNP2_MGlu dan SNP3_MGlu (reference dan alternate) menghasilkan produk PCR pada kedua kultivar yang diuji. Hal ini menunjukkan baik pada Klutuk Wulung maupun Barangan, kedua lokus tersebut mengandung alel heterozigot. SNP1_MGlu SNP2_MGlu SNP3_MGlu A. R A R A R A B. Gambar 40 Produk PCR hasil amplifikasi dari genom tanaman pisang cv. Klutuk Wulung (A) dan Barangan (B) menggunakan 6 pasang primer SNAP berdasarkan situs SNP pada gen MaGlu. R= primer reference, A= primer alternate

15 119 SNP1_MChi SNP2_MChi SNP3_MChi SNP4_MChi SNP5_MChi SNP6_MChi SNP7_MChi SNP8_MChi SNP9_MChi SNP10_MChi SNP11_MChi A. R A R A R A R A R A R A R A R A R A R A R A B. Gambar 41 Produk PCR hasil amplifikasi dari genom tanaman pisang cv. Klutuk Wulung (A) dan Barangan (B) menggunakan 22 pasang primer SNAP berdasarkan situs SNP pada gen MaChi. R= primer reference, A= primer alternate Hasil evaluasi 22 pasang primer SNAP berdasarkan fragmen gen chitinase menggunakan DNA genom pisang Klutuk Wulung dan Barangan ditampilkan pada Gambar 41. Berdasarkan elektroferogram (Gambar 41), pasangan primer yang diuji mampu menghasilkan produk PCR dan terdapat polimorfisme antar primer maupun antar kultivar pisang. Primer SNP4_MChi, SNP5_MChi, SNP7_MChi dan SNP11_MChi mampu menghasilkan produk PCR baik primer reference maupun alternate pada genom kedua kultivar pisang. Hal ini menunjukkan keempat lokus tersebut mempunyai kombinasi alel heterozigot pada kedua kultivar pisang. Lokus SNP1_MChi, SNP8_MChi dan SNP10_MChi mempunyai kombinasi alel heterozigot pada Klutuk Wulung, dan alel homozigot pada Barangan, sebaliknya primer SNP6_MChi dan SNP9_MChi mempunyai kombinasi alel heterozigot pada Barangan dan alel homozigot pada Klutuk Wulung. Lokus SNP2_MChi dan SNP3_MChi mengandung alel homozigot pada kedua kultivar pisang. Berdasarkan hasil pengujian tersebut dapat diketahui bahwa dari 11 lokus SNP yang diuji, Klutuk Wulung mempunyai 7 lokus heterozigot dan 4 lokus homozigot, sedangkan Barangan mempunyai 6 lokus heterozigot dan 5 lokus homozigot. Berdasarkan hasil pengujian tersebut dapat disarankan bahwa primer spesifik alel yang didisain bisa digunakan sebagai marka SNAP untuk keperluan analisis lebih lanjut. Sehubungan dengan pengembangan marka SNAP untuk marka ketahanan terhadap penyakit, marka molekuler berbasis SNP sebaiknya dikembangkan dari beberapa gen yang mempunyai peranan dalam ketahanan terhadap penyakit. Sebagai contoh implementasi marka SNAP berbasis SNP yang berasal dari gen MNBS dapat digabungkan dengan SNP yang berasal dari gen chitinase dan β- 1,3-glucanase tanaman pisang. Pemanfaatan SNP berbasis RGA dan DGA untuk Marka Ketahanan terhadap Penyakit Adanya keragaman SNP yang terkait (linkage) dengan fenotipe tertentu telah dilaporkan pada tanaman padi, kedelai dan bawang putih (Gupta et al. 2001). Mutasi akibat substitusi satu basa bisa merubah susunan asam amino dari polipeptida yang disandi oleh gen dan dapat merubah fungsi dari polipeptidanya (Kowarsch et al. 2010). Marka molekuler berbasis SNP dengan pendekatan PCR adalah lebih mudah dan efisien dalam pelaksanaannya bila dibandingkan dengan pendekatan enzim restriksi (Liu et al 2012). Salah satu marka molekular berbasis SNP yang menggunakan pendekatan teknik PCR adalah allel-specific PCR (AS-PCR) atau dikenal juga dengan nama SNAP (Drenkard et al. 2000).

16 120 Agar dapat dimanfaatkan sebagai marka ketahanan terhadap penyakit, marka SNAP berbasis RGA dan DGA perlu dievaluasi polimorfismenya dan keterkaitannya dengan sifat resistensi. Evaluasi tersebut perlu dilakukan untuk seluruh marka SNAP berbasis RGA dan DGA yang telah teridentifikasi. Apabila marka SNAP yang diuji mampu mengelompokkan kultivar atau spesies pisang yang berbeda-beda responnya terhadap penyakit, maka marka SNAP tersebut berpotensi digunakan sebagai marka untuk sifat resistensi penyakit. Evaluasi marka SNAP berbasis RGA pada 10 kultivar referensi. Hasil amplifikasi PCR menggunakan primer SNAP berbasis RGA pada 10 kultivar pisang ditampilkan pada Gambar 42. Dengan menggunakan primerprimer SNAP tersebut terlihat adanya polimorfisme pada produk amplifikasi PCR. Primer SNP1_MNBS (reference dan alternate) menghasilkan produk amplifikasi pada 10 kultivar yang diuji, hal ini berarti bahwa lokus SNP1_MNBS yang ada pada semua kultivar tersebut mengandung alel heterozigot, sedangkan primer SNAP yang lain menghasilkan produk amplifikasi yang beragam pada kesepuluh kultivar yang diuji (Gambar 42). Berdasarkan elektroferogram hasil amplifikasi PCR menggunakan primer SNAP berbasis RGA, diperoleh data genotipe seperti ditampilkan pada Tabel 26. Berdasarkan hasil analisis filogenetik terlihat bahwa semua primer SNAP berbasis RGA belum bisa mengelompokkan kultivar pisang berdasarkan sifat ketahanan terhadap penyakit layu FOC. Dalam dendogram tersebut, kultivar rentan berada dalam kelompok yang terpisah dan salah satu kultivar rentan Ambon Kuning menjadi satu kelompok dengan kultivar tahan FOC, Klutuk Wulung. Oleh karena itu untuk menjadikan primer SNAP sebagai marka ketahanan, tidak semua pasangan primer yang digunakan, tetapi dipilih salah satu atau beberapa pasang, serta dikombinasi dengan primer SNAP lain berbasis gen yang berperanan dalam ketahanan terhadap layu cendawan patogen SNP1_MNBS R A R A R A R A R A R A R A R A R A R A SNP2_MNBS SNP4_MNBS SNP5_MNBS SNP6_MNBS Gambar 42 Representasi analisis 5 primer SNAP berbasis RGA pada 10 kultivar pisang. R= primer reference, A= primer alternate, 1= Rejang, 2= Calcuta- 4, 3= Klutuk Wulung, 4= Kepok, 5= Jawaka, 6= Ketan, 7= Ambon Hijau, 8= Ambon Kuning, 9= Barangan, 10= Awak. R= primer reference, A= primer alternate

17 121 Tabel 26 Data genotipe hasil konversi dari elektroferogram produk PCR menggunakan primer SNAP berbasis RGA (MNBS) pada 10 kultivar pisang Kultivar SNP1_MNBS SNP2_MNBS SNP4_MNBS SNP5_MNBS SNP6_MNBS R A R A R A R A R A Rejang Calcuta Klutuk Wulung Kepok Jawaka Ketan Ambon Hijau Barangan Ambon Kuning Awak Keterangan: Jika (+)= ada produk, (-)= tidak ada produk, R(+)-A(-)= , R(-)-A(+)= , R(+)-A(+)= Pemilihan primer untuk marka SNAP dapat dilakukan dengan menganalisis setiap lokus. Analisis setiap lokus ini bertujuan untuk mendapatkan gambaran kemampuan setiap situs SNP dalam mengelompokan kultivar yang diuji berdasarkan sifat ketahanan terhadap penyakit layu FOC. Hasil analisis filogenetik setiap lokus untuk SNP berbasis RGA terhadap 10 kultivar pisang ditampilkan pada Lampiran 1. Berdasarkan hasil analisis terlihat bahwa primer SNP4_MNBS mampu mengelompokkan kultivar rentan (Ambon Kuning, Ambon Hijau dan Barangan) dalam satu kelompok, meskipun kultivar tahan Kepok dan Klutuk Wulung juga terikut dalam kelompok kultivar rentan. Kultivar tahan lainnya (Rejang, Calcuta-4, Jawaka dan Awak) sudah terkelompokkan menjadi satu. Dibandingkan dengan primer lainnya, primer SNP4_MNBS adalah primer yang lebih representatif, sehingga bisa digabungkan dengan primer SNAP berbasis gen chitinase dan β-1,3-glucanase sebagai marka ketahanan terhadap penyakit Coefficient Rejang (R) Jawaka (R) Awak (R) Klutuk_Wlg (R) Amb_Kng (S) Kepok (R) Ketan (R-S) Amb_Hj (S) Barangan (S) Calcuta-4 (R) Gambar 43 Dendogram hasil analisis filogenetik pengelompokkan kultivar berdasarkan hasil amplifikasi PCR menggunakan primer SNAP berbasis RGA (MNBS). Huruf dalam kurung di belakang kultivar menunjukkan karakter ketahanan masing-masing kultivar: R= tahan, S= rentan, R-S= rentan sampai tahan.

18 122 Evaluasi marka SNAP berbasis gen β-1,3-glucanase pada 10 kultivar referensi. Elektroferogram hasil amplifikasi primer SNAP berbasis gen β-1,3- glucanase ditampilkan pada Gambar 44. Berdasarkan hasil amplifikasi terlihat bahwa primer SNP1_MaGlu (reference dan alternate) menghasilkan polimorfisme pada produk amplifikasi PCR asal DNA genom 10 kultivar yang diuji, sedangkan dengan primer SNP2_MGlu dan SNP3_MGlu, baik pasangan primer reference maupun alternate semua menghasilkan produk amplifikasi pada 10 kultivar yang diuji (Gambar 44). Selanjutnya keberadaan pita amplifikasi dikonversi menjadi data binary ditampilkan pada Tabel 26 dan dendogram hasil analisis filogenetik ditampilkan pada Gambar 45. Berdasarkan dendogram pada Gambar 45, terlihat bahwa primer SNAP masih mengelompokkan kultivar rentan (Ambon Hijau, Ambon Kuning dan Barangan) menjadi satu dengan beberapa kultivar Rejang dan Calcuta-4. Oleh karena itu dalam aplikasinya primer SNAP berbasis gen β-1,3-glucanase tersebut perlu dikombinasi dengan primer SNAP berbasis RGA dan chitinase SNP1_MGlu R A R A R A R A R A R A R A R A R A R A SNP2_MGlu SNP3_MGlu Gambar44 Representasi analisis 5 primer SNAP berbasis gen β-1,3-glucanase pada 10 kultivar pisang. R= primer reference, A= primer alternate, 1= Rejang, 2= Calcuta-4, 3= Klutuk Wulung, 4= Kepok, 5= Jawaka, 6= Ketan, 7= Ambon Hijau, 8= Ambon Kuning, 9= Barangan, 10= Awak. Tabel 27 Data genotipe hasil konversi dari elektroferogram produk PCR menggunakan primer SNAP berbasis gen β-1,3-glucanase (MaGlu) pada 10 kultivar pisang Kultivar SNP1_MGlu SNP2_MGlu SNP3_MGlu R A R A R A Rejang Calcuta Klutuk Wulung Kepok Jawaka Ketan Ambon Hijau Barangan Ambon Kuning Awak Keterangan: Jika (+)= ada produk, (-)= tidak ada produk, R(+)-A(-)= , R(-)-A(+)= , R(+)-A(+)=

19 Coefficient Rejang (R) Calcuta-4 (R) Ketan (R-S) Amb_Hj (S) Barangan (S) Amb_Kng (S) Jawaka (R) Awak (R) Klutuk_Wlg (R) Kepok (R) Gambar 45 Dendogram hasil analisis filogenetik pengelompokkan kultivar berdasarkan hasil amplifikasi PCR menggunakan primer SNAP berbasis gen β-1,3-glucanase (MaGlu). Huruf dalam kurung di belakang kultivar menunjukkan karakter ketahanan masing-masing kultivar: R= tahan, S= rentan, R-S= rentan sampai tahan. Dalam proses analisis, data genotipe yang dianalisis hanya berdasarkan amplifikasi dari primer SNP1_MGlu saja, karena primer SNP lainnya menghasilkan produk yang monomorfik, sehingga kalaupun digunakan data tersebut, tidak akan mempengaruhi luaran, dalam hal ini hasil pengelompokkan dalam dendogram. Evaluasi marka SNAP berbasis gen chitinase pada 10 kultivar referensi. Amplifikasi PCR menggunakan primer SNAP berbasis gen chitinase yang diperoleh dari Percobaan 4 (Tabel 25) terhadap 10 kultivar pisang ditampilkan pada Gambar 46. Berdasarkan hasil amplifikasi PCR, terlihat adanya polimorfisme antar primer SNAP dan juga antar kultivar yang diuji. Primer SNP4_MChi, SNP5_MChi dan SNP7_MChi menghasilkan produk amplifikasi baik primer reference maupun alternate. Hal ini menunjukkan pada lokus tersebut, kesepuluh kultivar mengandung alel heterozigot, sedangkan primer SNAP yang lain menghasilkan produk amplifikasi yang beragam pada kesepuluh kultivar yang dievaluasi (Gambar 46) dan dikonversi menjadi data genotipe seperti ditampilkan dalam Tabel 28. Seperti halnya yang terjadi pada analisis filogenetik data genotipe berdasarkan gen β-1,3-glucanase, hasil skoring data monomorfik tidak digunakan untuk analisis data karena tidak mempengaruhi luaran yang tampak dalam dendogram. Hasil analisis filogenetik memperlihatkan semua primer SNAP berbasis gen chitinase belum bisa mengelompokkan kultivar pisang berdasarkan sifat ketahanan terhadap penyakit layu FOC. Kultivar-kultivar rentan seperti Ambon Hijau, Ambon Kuning dan Barangan berada dalam kelompok terpisah dan masing-masing bersama dengan kultivar tahan seperti Rejang dan Calcuta-4.

20 124 1 R 2 A R 3 A R 4 A R 5 A R 6 A R A R A R A R 10 A R A SNP1_MChi SNP2_MChi SNP3_MChi SNP4_MChi SNP5_MChi SNP6_MChi SNP7_MChi SNP8_MChi SNP9_MChi SNP10_MChi SNP11_MChi Gambar 46 Representasi analisis 5 primer SNAP berbasis gen chitinase pada 10 kultivar pisang. R= primer reference, A= primer alternate, 1= Rejang, 2= Calcuta-4, 3= Klutuk Wulung, 4= Kepok, 5= Jawaka, 6= Ketan, 7= Ambon Hijau, 8= Barangan, 9= Ambon Kuning, 10= Awak. Hal yang sama juga terjadi pada kultivar tahan FOC. Oleh karena itu untuk menjadikan primer SNAP sebagai marka ketahanan, tidak semua pasangan primer yang digunakan dan dipilih salah satu atau beberapa pasang, serta dikombinasi dengan primer SNAP lain berbasis gen yang berperanan dalam ketahanan terhadap patogen. Pemilihan primer untuk marka SNAP dapat dilakukan dengan menganalisis setiap lokus. Analisis setiap lokus ini bertujuan untuk mendapatkan gambaran kemampuan setiap situs SNP dalam mengelompokan kultivar yang diuji berdasarkan sifat ketahanan terhadap penyakit layu FOC. Keragaan hasil analisis setiap lokus ditampilkan pada Lampiran 2. Dari hasil analisis tiap lokus terpilih kombinasi lokus SNP2_MChi, SNP6_MChi, SNP8_MChi, SNP10_MChi dan SNP11_MChi yang digunakan sebagai marka SNAP. Hasil analisis filogenetik yang menggabungkan kelima lokus tersebut ditampilkan pada Gambar 48. Namun demikian pengelompokkan kultivar yang diperoleh masih belum sempurna mewakili pengelompokkan berdasarkan karakter ketahanan masing-masing kultivar terhadap FOC. Oleh karena itu dalam aplikasinya primer SNAP berbasis gen chitinase ini perlu dikombinasi dengan primer SNAP berbasis RGA dan β-1,3glucanase

21 125 Tabl 28 Data genotipe hasil konversi dari elektroferogram produk PCR menggunakan primer SNAP berbasis gen chitinase (MaChi) pada 10 kultivar pisang SNP1_MChi SNP2_MChi SNP3_MChi SNP4_MChi SNP5_MChi SNP6_MChi Kultivar R A R A R A R A R A R A Rejang Calcuta Klutuk Wlg Kepok Jawaka Ketan Ambon Hj Barangan Ambon Kng Awak Kultivar SNP7_MChi SNP8_MChi SNP9_MChi SNP10_MChi SNP11_MChi R A R A R A R A R A Rejang Calcuta Klutuk Wlg Kepok Jawaka Ketan Ambon Hj Barangan Ambon Kng Awak Keterangan: Jika (+)= ada produk, (-)= tidak ada produk, R(+)-A(-)= , R(-)-A(+)= , R(+)-A(+)= Coefficient Rejang (R) Amb_Hj (S) Kepok (R) Awak (R) Jawaka (R) Calcuta-4 (R) Amb_Kng (S) Ketan (R-S) Barangan (S) Klutuk_Wlg (R) Gambar 47 Dendogram hasil analisis filogenetik pengelompokkan kultivar berdasarkan hasil amplifikasi PCR menggunakan primer SNAP untuk 10 lokus berbasis gen chitinase (MaChi). Huruf dalam kurung di belakang kultivar menunjukkan karakter ketahanan masing-masing kultivar: R= tahan, S= rentan, R-S= rentan sampai tahan.

22 126 Rejang (R) Ketan (R-S) Amb_Hj (S) Amb_Kng (S) Calcuta-4 (R) Barangan (S) Klutuk_Wlg (R) Kepok (R) Jawaka (R) Awak (R) Coefficient Gambar 48 Dendogram hasil analisis filogenetik pengelompokkan kultivar berdasarkan hasil amplifikasi PCR menggunakan primer SNP2_MChi, SNP6_MChi, SNP8_MChi, SNP10_MChi dan SNP11_MChi. R= tahan, S= rentan, R-S= rentan sampai tahan. (A) (B) Gambar 49 Dendogram hasil analisis filogenetik pengelompokkan kultivar berdasarkan hasil amplifikasi PCR menggunakan primer SNP4_MNBS, SNP2_MChi, SNP6_MChi, SNP8_MChi, SNP10_MChi, SNP11_MChi yang melibatkan primer SNP1_MGlu (A) dan yang tidak (B). R= tahan, S= rentan, R-S= rentan sampai tahan.

23 127 Dengan menggabungkan primer-primer SNAP terpilih dari ketiga kelompok gen yang diperoleh dari penelitian ini, yaitu RGA (MNBS), β-1,3- glucanase dan chitinase, diperoleh pengelompokkan kultivar berdasarkan karakter ketahanan terhadap FOC yang lebih baik, seperti terlihat pada Gambar 49A dan 49B. Gambar 49A adalah melibatkan primer SNP1_MGlu sedangkan Gambar 49B tanpa melibatkan primer SNP1_MGlu. Dendogram yang dihasilkan baik tanpa atau dengan melibatkan primer SNP1_MGlu dapat mengelompokkan kultivar berdasarkan ketahanan terhadap FOC. Namun demikian dengan tanpa melibatkan primer SNP1_MGlu pengelompokkan yang diperoleh menjadi lebih baik (Gambar 49B) karena dapat memisahkan cabang kelompok kultivar rentan dengan kultivar tahan (pada koefisien kemiripan 83 %). Oleh karena itu untuk pengujian marka menggunakan kultivar/aksesi lain, tanpa melibatkan primer SNP1_MGlu. Evaluasi marka SNAP pada 10 kultivar/aksesi yang belum diketahui karakter ketahanan terhadap FOC. Dendogram hasil evaluasi yang dilakukan menggunakan DNA genom 10 kultivar/aksesi yang belum diketahui karakter ketahanan terhadap FOC bersama dengan 10 kultivar referensi, ditampilkan pada Gambar 50. Berdasarkan koefisien kemiripan sebesar 80 %, kultivar/aksesi tersebut dibagi menjadi 3 kelompok besar, yaitu R-I (kultivar resisten I) yang terdiri atas 3 kultivar, 2 kultivar adalah Rejang dan Calcuta-4 yang tahan FOC dan satu aksesi AMB-01 (Tongka Langit dari Maluku). Kelompok kedua adalah R-II (kultivar resisten II) yang terdiri atas 10 kultivar/aksesi. Yang termasuk dalam kelompok ini adalah Klutuk Wulung, Kepok, Jawaka dan Awak yang diketahui tahan FOC, dan beberapa kultivar seperti Muli, MDO-01, MBO-04, MLU-07, SUM-04 serta satu spesies liar HlbS-01. Kelompok ketiga adalah S (rentan) yang beranggotakan beberapa kultivar rentan seperti Ambon Hijau, Ambon Kuning, Barangan dan yang rentan sampai tahan yaitu Ketan. Kultivar Ketan sebetulnya termasuk kultivar yang toleran atau mempunyai ketahanan terhadap FOC sedang. Namun demikian hal ini juga mengkonfirmasi hasil Percobaan 1 (BAB II) bahwa meskipun Ketan dikategorikan kultivar tahan (Tabel 2), tetapi sebanyak 42.% tanaman menunjukkan gejala RDI dan LSI sedang (LSI= 2-3 dan RDI= 2-3), jadi sebetulnya Ketan adalah kultivar yang mempunyai tingkat ketahanan rentan sampai tahan terhadap FOC. Dalam kelompok ketiga ini juga terdapat satu spesies liar Slk-29 dan 2 kultivar (SUM-01 dan HyKC). Walaupun berdasarkan hasil analisis filogenetik marka SNAP terpilih bisa mengelompokkan kultivar berdasarkan ketahanan terhadap FOC, tetapi markamarka tersebut perlu diuji pada populasi bersegregasi. Selain itu untuk validasi marka, diperlukan pengujian lebih lanjut terhadap aksesi-aksesi lain yang juga diuji ketahanannya terhadap cendawan FOC. Namun demikian metode ini merupakan tahapan awal pada pemilihan marka SNAP berdasar situs SNP yang terdapat dalam gen yang bertanggung jawab pada ketahanan dan pertahanan tanaman terhadap patogen. Selain itu, dari penelitian ini dapat diketahui bahwa terdapat perbedaan susunan basa nukleotida antara kultivar pisang yang rentan dan tahan terhadap penyakit layu FOC, dan perbedaan nukleotida tersebut bisa merubah residu asam amino.

BAB VIII PEMBAHASAN UMUM

BAB VIII PEMBAHASAN UMUM BAB VIII PEMBAHASAN UMUM Pengembangan tanaman pisang di Indonesia masih terus berlangsung walaupun menghadapi beberapa kendala baik kendala teknis maupun non teknis. Kendala non teknis berupa makin berkurangnya

Lebih terperinci

J. Hort. Vol. 23 No. 4, 2013 J. Hort. 23(4): , Sutanto, A 1), Hermanto, C 1), Sukma, D 2), dan Sudarsono 2) 1)

J. Hort. Vol. 23 No. 4, 2013 J. Hort. 23(4): , Sutanto, A 1), Hermanto, C 1), Sukma, D 2), dan Sudarsono 2) 1) J. Hort. Vol. 23 No. 4, 2013 J. Hort. 23(4):300-309, 2013 Pengembangan Marka SNAP Berbasis Resistance Gene Analogue Pada Tanaman Pisang (Musa spp.) (Development of SNAP Marker Based On Resistance Gene

Lebih terperinci

HASIL DAN PEMBAHASAN. divisualisasikan padaa gel agarose seperti terlihat pada Gambar 4.1. Ukuran pita

HASIL DAN PEMBAHASAN. divisualisasikan padaa gel agarose seperti terlihat pada Gambar 4.1. Ukuran pita IV. HASIL DAN PEMBAHASAN 4.1. Amplifikasi Gen Mx Amplifikasi gen Mx telah berhasil dilakukan. Hasil amplifikasi gen Mx divisualisasikan padaa gel agarose seperti terlihat pada Gambar 4.1. Ukuran pita yang

Lebih terperinci

KARAKTERISASI MOLEKULER KETAHANAN BEBERAPA KULTIVAR PISANG (Musa spp.) TERHADAP PENYAKIT LAYU PANAMA (Fusarium oxysporum f.sp. cubense) AGUS SUTANTO

KARAKTERISASI MOLEKULER KETAHANAN BEBERAPA KULTIVAR PISANG (Musa spp.) TERHADAP PENYAKIT LAYU PANAMA (Fusarium oxysporum f.sp. cubense) AGUS SUTANTO KARAKTERISASI MOLEKULER KETAHANAN BEBERAPA KULTIVAR PISANG (Musa spp.) TERHADAP PENYAKIT LAYU PANAMA (Fusarium oxysporum f.sp. cubense) AGUS SUTANTO SEKOLAH PASCASARJANA INSTITUT PERTANIAN BOGOR BOGOR

Lebih terperinci

DASAR BIOTEKNOLOGI TANAMAN

DASAR BIOTEKNOLOGI TANAMAN DASAR BIOTEKNOLOGI TANAMAN Darda Efendi, Ph.D Nurul Khumaida, Ph.D Sintho W. Ardie, Ph.D Departemen Agronomi dan Hortikultura, Faperta, IPB 2013 Marka = tanda Marka (marka biologi) adalah sesuatu/penanda

Lebih terperinci

BAB 4 HASIL PERCOBAAN DAN PEMBAHASAN

BAB 4 HASIL PERCOBAAN DAN PEMBAHASAN BAB 4 HASIL PERCOBAAN DAN PEMBAHASAN Sebelum melakukan PCR, terlebih dahulu dilakukan perancangan primer menggunakan program DNA Star. Pemilihan primer dilakukan dengan mempertimbangkan parameter spesifisitas,

Lebih terperinci

MATERI DAN METODE. Kota Padang Sumatera Barat pada bulan Oktober Amplifikasi gen Growth

MATERI DAN METODE. Kota Padang Sumatera Barat pada bulan Oktober Amplifikasi gen Growth III. MATERI DAN METODE 3.1 Waktu dan Tempat Pengambilan sampel darah domba dilakukan di Kecamatan Koto Tengah Kota Padang Sumatera Barat pada bulan Oktober 2012. Amplifikasi gen Growth Hormone menggunakan

Lebih terperinci

I. PENDAHULUAN. Jenis kelamin menjadi salah satu studi genetik yang menarik pada tanaman

I. PENDAHULUAN. Jenis kelamin menjadi salah satu studi genetik yang menarik pada tanaman I. PENDAHULUAN 1.1 Latar Belakang Jenis kelamin menjadi salah satu studi genetik yang menarik pada tanaman dioecious. Jenis kelamin betina menjamin keberlangsungan hidup suatu individu, dan juga penting

Lebih terperinci

BAB III METODE PENELITIAN Bagan Alir Penelitian ini secara umum dapat digambarkan pada skema berikut:

BAB III METODE PENELITIAN Bagan Alir Penelitian ini secara umum dapat digambarkan pada skema berikut: BAB III METODE PENELITIAN Tahapan-tahapan yang dilakukan dalam penelitian ini adalah: pengumpulan sampel, lisis terhadap sampel mtdna yang telah diperoleh, amplifikasi daerah HVI mtdna sampel dengan menggunakan

Lebih terperinci

ANALISIS KERAGAMAN GENETIK MUTAN JARAK PAGAR (Jatropha curcas L.) HASIL PERLAKUAN MUTAGEN KOLKISIN BERDASARKAN PENANDA MOLEKULER RAPD

ANALISIS KERAGAMAN GENETIK MUTAN JARAK PAGAR (Jatropha curcas L.) HASIL PERLAKUAN MUTAGEN KOLKISIN BERDASARKAN PENANDA MOLEKULER RAPD ANALISIS KERAGAMAN GENETIK MUTAN JARAK PAGAR (Jatropha curcas L.) HASIL PERLAKUAN MUTAGEN KOLKISIN BERDASARKAN PENANDA MOLEKULER RAPD Herdiyana Fitriani Dosen Program Studi Pendidikan Biologi FPMIPA IKIP

Lebih terperinci

Elektroforesis Hasil Amplifikasi Analisis Segregasi Marka SSR Amplifikasi DNA Kelapa Sawit dengan Primer Mikrosatelit HASIL DAN PEMBAHASAN

Elektroforesis Hasil Amplifikasi Analisis Segregasi Marka SSR Amplifikasi DNA Kelapa Sawit dengan Primer Mikrosatelit HASIL DAN PEMBAHASAN 11 annealing yang tepat dengan mengatur reaksi pada berbagai suhu dalam satu reaksi sekaligus sehingga lebih efektif dan efisien. Proses optimasi dilakukan menggunakan satu sampel DNA kelapa sawit yaitu

Lebih terperinci

BAB 4 HASIL PERCOBAAN DAN BAHASAN. Oligonukleotida sintetis daerah pengkode IFNα2b sintetis dirancang menggunakan

BAB 4 HASIL PERCOBAAN DAN BAHASAN. Oligonukleotida sintetis daerah pengkode IFNα2b sintetis dirancang menggunakan BAB 4 HASIL PERCOBAAN DAN BAHASAN Oligonukleotida sintetis daerah pengkode IFNα2b sintetis dirancang menggunakan program komputer berdasarkan metode sintesis dua arah TBIO, dimana proses sintesis daerah

Lebih terperinci

ANALISA HASIL TRANSFORMASI DENGAN MENGGUNAKAN PCR KOLONI DAN RESTRIKSI

ANALISA HASIL TRANSFORMASI DENGAN MENGGUNAKAN PCR KOLONI DAN RESTRIKSI 1 ANALISA HASIL TRANSFORMASI DENGAN MENGGUNAKAN PCR KOLONI DAN RESTRIKSI PENDAHULUAN Polimerase Chain Reaction (PCR) PCR adalah suatu reaksi invitro untuk menggandakan jumlah molekul DNA pada target tertentu

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN A. Jenis penelitian Jenis penelitian ini adalah penelitian deskriptif yang mengangkat fenomena alam sebagai salah satu masalah dalam penelitian, sehingga dapat menerangkan arti

Lebih terperinci

BAB XII. REAKSI POLIMERISASI BERANTAI

BAB XII. REAKSI POLIMERISASI BERANTAI BAB XII. REAKSI POLIMERISASI BERANTAI Di dalam Bab XII ini akan dibahas pengertian dan kegunaan teknik Reaksi Polimerisasi Berantai atau Polymerase Chain Reaction (PCR) serta komponen-komponen dan tahapan

Lebih terperinci

PENDAHULUAN. Latar Belakang

PENDAHULUAN. Latar Belakang PENDAHULUAN Latar Belakang Usaha peternakan di Provinsi Nanggroe Aceh Darussalam secara umum telah dilakukan secara turun temurun meskipun dalam jumlah kecil skala rumah tangga, namun usaha tersebut telah

Lebih terperinci

BAB IV HASIL DAN PEMBAHASAN. Sintesis fragmen gen HA Avian Influenza Virus (AIV) galur

BAB IV HASIL DAN PEMBAHASAN. Sintesis fragmen gen HA Avian Influenza Virus (AIV) galur 20 BAB IV HASIL DAN PEMBAHASAN A. KONDISI OPTIMAL REAKSI AMPLIFIKASI Sintesis fragmen 688--1119 gen HA Avian Influenza Virus (AIV) galur A/Indonesia/5/2005 dilakukan dengan teknik overlapping extension

Lebih terperinci

HASIL DAN PEMBAHASAN. Amplifikasi Daerah D-loop M B1 B2 B3 M1 M2 P1 P2 (-)

HASIL DAN PEMBAHASAN. Amplifikasi Daerah D-loop M B1 B2 B3 M1 M2 P1 P2 (-) HASIL DAN PEMBAHASAN Amplifikasi Daerah D-loop Amplifikasi daerah D-loop DNA mitokondria (mtdna) pada sampel DNA sapi Bali, Madura, Pesisir, Aceh, dan PO dilakukan dengan menggunakan mesin PCR Applied

Lebih terperinci

4 Hasil dan Pembahasan

4 Hasil dan Pembahasan 4 Hasil dan Pembahasan Dalam bab ini akan dipaparkan hasil dari tahap-tahap penelitian yang telah dilakukan. Melalui tahapan tersebut diperoleh urutan nukleotida sampel yang positif diabetes dan sampel

Lebih terperinci

BAB 4 HASIL PERCOBAAN DAN BAHASAN

BAB 4 HASIL PERCOBAAN DAN BAHASAN 14 BAB 4 HASIL PERCOBAAN DAN BAHASAN Konfirmasi bakteri C. violaceum dan B. cereus dilakukan dengan pewarnaan Gram, identifikasi morfologi sel bakteri, sekuensing PCR 16s rdna dan uji kualitatif aktivitas

Lebih terperinci

PENANDA KODOMINAN B11 BERDASARKAN CAPS SEBAGAI ALAT SELEKSI TOLERANSI TANAMAN PADI TERHADAP CEKAMAN ALUMINIUM *)

PENANDA KODOMINAN B11 BERDASARKAN CAPS SEBAGAI ALAT SELEKSI TOLERANSI TANAMAN PADI TERHADAP CEKAMAN ALUMINIUM *) PENANDA KODOMINAN B11 BERDASARKAN CAPS SEBAGAI ALAT SELEKSI TOLERANSI TANAMAN PADI TERHADAP CEKAMAN ALUMINIUM *) (CAPS Based Codominant Marker Of B11 as Selective Tool for Rice Aluminum Tolerance Trait)

Lebih terperinci

BAB III. METODOLOGI PENELITIAN. Pengambilan sampel. Penyiapan templat mtdna dengan metode lisis sel

BAB III. METODOLOGI PENELITIAN. Pengambilan sampel. Penyiapan templat mtdna dengan metode lisis sel 16 BAB III. METODOLOGI PENELITIAN Bab ini menggambarkan tahapan penelitian yang terdiri dari pengambilan sampel, penyiapan templat mtdna dengan metode lisis sel, amplifikasi D-loop mtdna dengan teknik

Lebih terperinci

1 0,53 0,59 2 0,3 0,2 3 0,02 0,02 4 0,04 0,04 5 0,3 0,3 Ilustrasi rangkaian isolasi DNA tersebut dapat dilihat pada Gambar 1 berikut.

1 0,53 0,59 2 0,3 0,2 3 0,02 0,02 4 0,04 0,04 5 0,3 0,3 Ilustrasi rangkaian isolasi DNA tersebut dapat dilihat pada Gambar 1 berikut. PERBANDINGAN BEBERAPA METODE ISOLASI DNA UNTUK PENENTUAN KUALITAS LARUTAN DNA TANAMAN SINGKONG (Manihot esculentum L.) Molekul DNA dalam suatu sel dapat diekstraksi atau diisolasi untuk berbagai macam

Lebih terperinci

TINJAUAN PUSTAKA Sapi Perah Friesian Holstein

TINJAUAN PUSTAKA Sapi Perah Friesian Holstein TINJAUAN PUSTAKA Sapi Perah Friesian Holstein Sapi Friesian Holstein (FH) merupakan bangsa sapi yang paling banyak terdapat di Amerika Serikat, sekitar 80-90% dari seluruh sapi perah yang berada di sana.

Lebih terperinci

III. MATERI DAN METODE A.

III. MATERI DAN METODE A. III. MATERI DAN METODE A. Waktu dan Tempat Penelitian Penelitian ini dilaksanakan pada bulan September sampai dengan Desember 2015. Proses isolasi DNA, simplex-pcr dan duplex-pcr dilaksanakan di Sub Laboratorium

Lebih terperinci

Saintek Vol 5, No 6, Tahun 2010 POLYMERASE CHAIN REACTION (PCR) Zuhriana K.Yusuf

Saintek Vol 5, No 6, Tahun 2010 POLYMERASE CHAIN REACTION (PCR) Zuhriana K.Yusuf Saintek Vol 5, No 6, Tahun 2010 POLYMERASE CHAIN REACTION (PCR) Zuhriana K.Yusuf Staf Pengajar Jurusan Kesehatan Masyarakat FIKK Universitas Negeri Gorontalo Abstrak (Polymerase Chain Reaction, PCR) adalah

Lebih terperinci

I. PENDAHULUAN. A. Latar Belakang. Jeruk merupakan salah satu tanaman buah yang penting dan

I. PENDAHULUAN. A. Latar Belakang. Jeruk merupakan salah satu tanaman buah yang penting dan I. PENDAHULUAN A. Latar Belakang Jeruk merupakan salah satu tanaman buah yang penting dan dibudidayakan secara luas di Indonesia. Hal ini terlihat dari total produksi jeruk di Indonesia menduduki peringkat

Lebih terperinci

Metodologi Penelitian. Metode, bahan dan alat yang digunakan dalam penelitian ini akan dipaparkan pada bab ini.

Metodologi Penelitian. Metode, bahan dan alat yang digunakan dalam penelitian ini akan dipaparkan pada bab ini. Bab III Metodologi Penelitian Metode, bahan dan alat yang digunakan dalam penelitian ini akan dipaparkan pada bab ini. III.1 Rancangan Penelitian Secara garis besar tahapan penelitian dijelaskan pada diagram

Lebih terperinci

BAB III METODOLOGI PENELITIAN. Pada penelitian ini terdapat lima tahapan penelitian yang dilakukan yaitu

BAB III METODOLOGI PENELITIAN. Pada penelitian ini terdapat lima tahapan penelitian yang dilakukan yaitu BAB III METODOLOGI PENELITIAN Pada penelitian ini terdapat lima tahapan penelitian yang dilakukan yaitu pengumpulan sampel berupa akar rambut, ekstraksi mtdna melalui proses lisis akar rambut, amplifikasi

Lebih terperinci

Laporan Tahunan 2015: Inovasi Pertanian Bioindustri Menuju Kedaulatan Pangan dan Kesejahteraan Petani

Laporan Tahunan 2015: Inovasi Pertanian Bioindustri Menuju Kedaulatan Pangan dan Kesejahteraan Petani 78 Laporan Tahunan 2015: Inovasi Pertanian Bioindustri Menuju Kedaulatan Pangan dan Kesejahteraan Petani Bioteknologi dan Sumber Daya Genetik Kemajuan teknologi genomika telah membuka khasanah baru dalam

Lebih terperinci

TINJAUAN PUSTAKA. berikut: Kingdom Plantae, divisi Spermatophyta, subdivisi Angiospermae,

TINJAUAN PUSTAKA. berikut: Kingdom Plantae, divisi Spermatophyta, subdivisi Angiospermae, TINJAUAN PUSTAKA Botani Tanaman Menurut Van Steenis (2003) bawang merah dapat diklasifikasikan sebagai berikut: Kingdom Plantae, divisi Spermatophyta, subdivisi Angiospermae, kelas Monocotyledonae, ordo

Lebih terperinci

BAB IV HASIL DAN PEMBAHASAN. telah banyak dilakukan sebelumnya menunjukkan bahwa fenomena munculnya

BAB IV HASIL DAN PEMBAHASAN. telah banyak dilakukan sebelumnya menunjukkan bahwa fenomena munculnya BAB IV HASIL DAN PEMBAHASAN Penelitian terhadap urutan nukleotida daerah HVI mtdna manusia yang telah banyak dilakukan sebelumnya menunjukkan bahwa fenomena munculnya rangkaian poli-c merupakan fenomena

Lebih terperinci

BAB IV HASIL DAN PEMBAHASAN

BAB IV HASIL DAN PEMBAHASAN 15 BAB IV HASIL DAN PEMBAHASAN 4.1 Analisis DNA 4.1.1 Ekstraksi DNA Ekstraksi DNA merupakan langkah awal dalam analisis molekuler. Masalah-masalah yang timbul dalam ekstraksi DNA merupakan hal yang penting

Lebih terperinci

BAHAN DAN METODE Tempat dan Waktu Penelitian Bahan dan Alat

BAHAN DAN METODE Tempat dan Waktu Penelitian Bahan dan Alat 12 BAHAN DAN METODE Tempat dan Waktu Penelitian Survei penyakit klorosis dan koleksi sampel tanaman tomat sakit dilakukan di sentra produksi tomat di daerah Cianjur, Cipanas, Lembang, dan Garut. Deteksi

Lebih terperinci

menggunakan program MEGA versi

menggunakan program MEGA versi DAFTAR ISI COVER... i HALAMAN PENGESAHAN... ii HALAMAN PERSEMBAHAN... iii PRAKATA... iv DAFTAR ISI... vi DAFTAR TABEL... viii DAFTAR GAMBAR... ix DAFTAR LAMPIRAN... x INTISARI... xi ABSTRACT... xii PENDAHULUAN...

Lebih terperinci

BAB I PENDAHULUAN 1.1 Latar Belakang

BAB I PENDAHULUAN 1.1 Latar Belakang BAB I PENDAHULUAN 1.1 Latar Belakang Ikan sebagai salah satu sumber protein hewani mengandung semua jenis asam amino esensial yang diperlukan oleh tubuh manusia (Suhartini dan Nur 2005 dalam Granada 2011),

Lebih terperinci

(A) 530C-550C; (B) 560C, 570C, 580C, 600C; (C) 590C, 610C, 620C; (D)

(A) 530C-550C; (B) 560C, 570C, 580C, 600C; (C) 590C, 610C, 620C; (D) 2 melawan mikroba. Peran flavonol dalam bidang kesehatan sebagai antiinflamatori, antioksidan, antiproliferatif, menekan fotohemolisis eritrosit manusia, dan mengakhiri reaksi rantai radikal bebas (Albert

Lebih terperinci

KERAGAMAN Musa acuminata Colla LIAR DENGAN PENDEKATAN MORFOLOGI DAN MOLEKULER

KERAGAMAN Musa acuminata Colla LIAR DENGAN PENDEKATAN MORFOLOGI DAN MOLEKULER KERAGAMAN Musa acuminata Colla LIAR DENGAN PENDEKATAN MORFOLOGI DAN MOLEKULER SKRIPSI Diajukan untuk memenuhi salah satu syarat mencapai derajat Sarjana Sains (S.Si) Pada Jurusan Biologi Fakultas Matematika

Lebih terperinci

HALAMAN JUDUL HALAMAN PENGESAHAN PERNYATAAN KEASLIAN PENULISAN PRAKATA DAFTAR ISI DAFTAR GAMBAR DAFTAR TABEL DAFTAR LAMPIRAN INTISARI ABSTRACT BAB I

HALAMAN JUDUL HALAMAN PENGESAHAN PERNYATAAN KEASLIAN PENULISAN PRAKATA DAFTAR ISI DAFTAR GAMBAR DAFTAR TABEL DAFTAR LAMPIRAN INTISARI ABSTRACT BAB I DAFTAR ISI HALAMAN JUDUL... i HALAMAN PENGESAHAN... ii PERNYATAAN KEASLIAN PENULISAN... iii PRAKATA... iv DAFTAR ISI... vi DAFTAR GAMBAR... viii DAFTAR TABEL... ix DAFTAR LAMPIRAN... x INTISARI... xi ABSTRACT...

Lebih terperinci

PENGANTAR. Latar Belakang. Itik yang dikenal saat ini adalah hasil penjinakan itik liar (Anas Boscha atau

PENGANTAR. Latar Belakang. Itik yang dikenal saat ini adalah hasil penjinakan itik liar (Anas Boscha atau PENGANTAR Latar Belakang Itik yang dikenal saat ini adalah hasil penjinakan itik liar (Anas Boscha atau Wild Mallard). Proses penjinakan telah terjadi berabad-abad yang lalu dan di Asia Tenggara merupakan

Lebih terperinci

Keragaman Molekuler pada Tanaman Lili Hujan (Zephyranthes spp.) Molecular Variance in Rain Lily (Zephyranthes spp.)

Keragaman Molekuler pada Tanaman Lili Hujan (Zephyranthes spp.) Molecular Variance in Rain Lily (Zephyranthes spp.) Vegetalika Vol.4 No.1, 2015 : 70-77 Keragaman Molekuler pada Tanaman Lili Hujan (Zephyranthes spp.) Molecular Variance in Rain Lily (Zephyranthes spp.) Tenti Okta Vika 1, Aziz Purwantoro 2, dan Rani Agustina

Lebih terperinci

TINJAUAN PUSTAKA. Suprijatna dkk. (2005) mengemukakan taksonomi ayam kampung adalah

TINJAUAN PUSTAKA. Suprijatna dkk. (2005) mengemukakan taksonomi ayam kampung adalah II. TINJAUAN PUSTAKA 2.1. Tinjauan Umum tentang Ayam Kampung Suprijatna dkk. (2005) mengemukakan taksonomi ayam kampung adalah sebagai berikut : Kingdom : Animalia, Phylum : Chordata, Subphylum : Vertebrata,

Lebih terperinci

2015 ISOLASI DNA PARSIAL GEN

2015 ISOLASI DNA PARSIAL GEN 1 BAB I PENDAHULUAN A. Latar Belakang Penelitian Ikan gurame (Osphronemus merupakan salah satu ikan air tawar yang termasuk ke dalam infraclass Teleostei (Integrated Taxonomic Information System, 2012).

Lebih terperinci

MACAM-MACAM TIPE PCR DAN TEKNIK PEMOTONGAN PROTEIN DENGAN METODE EDMAN SEBAGAI DASAR KERJA ANALISIS SEKUENSING

MACAM-MACAM TIPE PCR DAN TEKNIK PEMOTONGAN PROTEIN DENGAN METODE EDMAN SEBAGAI DASAR KERJA ANALISIS SEKUENSING TUGAS GENETIKA MOLEKULER MACAM-MACAM TIPE PCR DAN TEKNIK PEMOTONGAN PROTEIN DENGAN METODE EDMAN SEBAGAI DASAR KERJA ANALISIS SEKUENSING Oleh: Laurencius Sihotang 8756130889 Program Studi Magister Pendidikan

Lebih terperinci

BAB IV. HASIL DAN PEMBAHASAN

BAB IV. HASIL DAN PEMBAHASAN BAB IV. HASIL DAN PEMBAHASAN Pada bab ini akan disajikan hasil dan pembahasan berdasarkan langkah-langkah penelitian yang telah diuraikan dalam bab sebelumnya dalam empat bagian yang meliputi; sampel mtdna,

Lebih terperinci

BAB III METODE PENELITIAN. Jenis penelitian yang digunakan adalah penelitian deskriptif.

BAB III METODE PENELITIAN. Jenis penelitian yang digunakan adalah penelitian deskriptif. 24 BAB III METODE PENELITIAN 3.1 Jenis Penelitian Jenis penelitian yang digunakan adalah penelitian deskriptif. 3.2 Objek Penelitian DNA ikan gurame (Osphronemus goramy Lac.) yang resisten dan sensitif

Lebih terperinci

AMPLIFIKASI GEN CYTOCHROME OXIDASE SUBUNIT I (COI) DARI SAMPEL SIRIP IKAN HIU DENGAN MENGGUNAKAN BEBERAPA PASANGAN PRIMER

AMPLIFIKASI GEN CYTOCHROME OXIDASE SUBUNIT I (COI) DARI SAMPEL SIRIP IKAN HIU DENGAN MENGGUNAKAN BEBERAPA PASANGAN PRIMER AMPLIFIKASI GEN CYTOCHROME OXIDASE SUBUNIT I (COI) DARI SAMPEL SIRIP IKAN HIU DENGAN MENGGUNAKAN BEBERAPA PASANGAN PRIMER (Amplification of Cytochrome Oxidase Subunit I (COI) Gene from Shark Fin Samples

Lebih terperinci

ANALISIS SIDIK DNA (DNA Fingerprinting) RFLP (Restriction Fragmen Length Polymorphism)

ANALISIS SIDIK DNA (DNA Fingerprinting) RFLP (Restriction Fragmen Length Polymorphism) ANALISIS SIDIK DNA (DNA Fingerprinting) RFLP (Restriction Fragmen Length Polymorphism) Laurencius Sihotang I. Tujuan Mempelajari cara teknik RFLP(Restriction Fragmen Length Polymorphism) Menganalisis pola

Lebih terperinci

1. PENDAHULUAN. Kedelai merupakan tanaman asli daratan Cina dan telah dibudidayakan sejak 2500

1. PENDAHULUAN. Kedelai merupakan tanaman asli daratan Cina dan telah dibudidayakan sejak 2500 1. PENDAHULUAN 1.1 Latar Belakang Masalah Kedelai merupakan tanaman asli daratan Cina dan telah dibudidayakan sejak 2500 SM. Sejalan dengan makin berkembangnya perdagangan antarnegara yang terjadi pada

Lebih terperinci

HASIL DAN PEMBAHASAN. Hasil

HASIL DAN PEMBAHASAN. Hasil 11 secara perlahan beberapa kali kemudian segera ditambah dengan 400 μl larutan buffer netralisasi (1.32 M natrium asetat ph 4.8), divorteks dan disentrifugasi pada suhu 4 0 C dengan kecepatan 10 000 rpm

Lebih terperinci

BAB I PENDAHULUAN 1.1 Latar Belakang

BAB I PENDAHULUAN 1.1 Latar Belakang BAB I PENDAHULUAN 1.1 Latar Belakang Maskoki memiliki keindahan dan daya tarik tersendiri karena bentuk dan ukuran tubuhnya serta keindahan pada variasi warna dan corak yang beragam (Perkasa & Abdullah

Lebih terperinci

BAB III METODOLOGI PENELITIAN. Penelitian yang dilakukan termasuk ke dalam penelitian dasar dimana adanya

BAB III METODOLOGI PENELITIAN. Penelitian yang dilakukan termasuk ke dalam penelitian dasar dimana adanya BAB III METODOLOGI PENELITIAN A. Jenis Penelitian Penelitian yang dilakukan termasuk ke dalam penelitian dasar dimana adanya keingintahuan peneliti terhadap hasil suatu aktivitas. Metode penelitian ini

Lebih terperinci

AMPLIFIKASI in vitro GEN PENGKODE PEMSILIN V ASILASE dari Bacillus sp. strain BACS

AMPLIFIKASI in vitro GEN PENGKODE PEMSILIN V ASILASE dari Bacillus sp. strain BACS ABSTRAK' AMPLIFIKASI in vitro GEN PENGKODE PEMSILIN V ASILASE dari Bacillus sp. strain BACS Di dalam materi genetik Bacillus sp. strain diketahui - - ' terdapat gen Penisilin V Asilase. Hal ini terbukti

Lebih terperinci

ABSTRAK. Analisis Mutasi Gen Pengekspresi Domain B dan C DNA Polimerase HBV Dari Pasien Yang Terinfeksi Dengan Titer Rendah.

ABSTRAK. Analisis Mutasi Gen Pengekspresi Domain B dan C DNA Polimerase HBV Dari Pasien Yang Terinfeksi Dengan Titer Rendah. ABSTRAK Analisis Mutasi Gen Pengekspresi Domain B dan C DNA Polimerase HBV Dari Pasien Yang Terinfeksi Dengan Titer Rendah. Natalia, 2006 Pembimbing Utama Pembimbing Pendamping : Johan Lucianus, dr., M.Si.

Lebih terperinci

PERBANDINGAN POLA PITA AMPLIFIKASI DNA DAUN, BUNGA, DAN BUAH KELAPA SAWIT NORMAL DAN ABNORMAL ALFINIA AZIZAH

PERBANDINGAN POLA PITA AMPLIFIKASI DNA DAUN, BUNGA, DAN BUAH KELAPA SAWIT NORMAL DAN ABNORMAL ALFINIA AZIZAH PERBANDINGAN POLA PITA AMPLIFIKASI DNA DAUN, BUNGA, DAN BUAH KELAPA SAWIT NORMAL DAN ABNORMAL ALFINIA AZIZAH PROGRAM STUDI BIOKIMIA FAKULTAS MATEMATIKA DAN ILMU PENGETAHUAN ALAM INSTITUT PERTANIAN BOGOR

Lebih terperinci

HASIL DAN PEMBAHASAN. pb M 1 2. pb M 1 2. pb M 1 2. (a) (b) pb M 1 2. pb M pb M 1 2. pb M (d) (e) (c)

HASIL DAN PEMBAHASAN. pb M 1 2. pb M 1 2. pb M 1 2. (a) (b) pb M 1 2. pb M pb M 1 2. pb M (d) (e) (c) HASIL DAN PEMBAHASAN Amplifikasi dan Visualisasi DNA Endo-β- 1,4- glukanase C. curvignathus Amplifikasi DNA ekson 1 dan 5 CcEG menggunakan pasangan primer eksternal (Tabel 2) dan masing-masing menunjukkan

Lebih terperinci

LAPORAN PRAKTIKUM REKAYASA GENETIKA

LAPORAN PRAKTIKUM REKAYASA GENETIKA LAPORAN PRAKTIKUM REKAYASA GENETIKA LAPORAN II (ISOLASI DNA GENOM) KHAIRUL ANAM P051090031/BTK BIOTEKNOLOGI SEKOLAH PASCASARJANA INSTITUT PERTANIAN BOGOR 2010 0 ISOLASI DAN IDENTIFIKASI DNA SEL MUKOSA

Lebih terperinci

I. PENGENALAN NATIONAL CENTRE FOR BIOTECHNOLOGY INFORMATION (NCBI)

I. PENGENALAN NATIONAL CENTRE FOR BIOTECHNOLOGY INFORMATION (NCBI) I. PENGENALAN NATIONAL CENTRE FOR BIOTECHNOLOGY INFORMATION (NCBI) A. PENDAHULUAN NCBI (National Centre for Biotechnology Information) merupakan suatu institusi yang menyediakan sumber informasi terkait

Lebih terperinci

BAB IV HASIL DAN PEMBAHASAN. dari daun pertama pada pucuk. Genom merupakan seluruh materi DNA

BAB IV HASIL DAN PEMBAHASAN. dari daun pertama pada pucuk. Genom merupakan seluruh materi DNA BAB IV HASIL DAN PEMBAHASAN A. ISOLASI GENOM JARAK PAGAR Genom jarak pagar diisolasi dari daun jarak pagar muda yang diambil dari daun pertama pada pucuk. Genom merupakan seluruh materi DNA pada suatu

Lebih terperinci

2015 ISOLASI DAN AMPLIFIKASI GEN PARSIAL MELANOCORTIN - 1 RECEPTOR (MC1R) PADA IKAN GURAME

2015 ISOLASI DAN AMPLIFIKASI GEN PARSIAL MELANOCORTIN - 1 RECEPTOR (MC1R) PADA IKAN GURAME BAB I PENDAHULUAN A. Latar Belakang Indonesia merupakan salah satu negara mega biodiversity di dunia yang memiliki kekayaan ekosistem beragam, salah satunya adalah ekosistem perairan air tawar yang memiliki

Lebih terperinci

ANALISIS VARIASI NUKLEOTIDA DAERAH D-LOOP DNA MITOKONDRIA PADA SATU INDIVIDU SUKU BALI NORMAL

ANALISIS VARIASI NUKLEOTIDA DAERAH D-LOOP DNA MITOKONDRIA PADA SATU INDIVIDU SUKU BALI NORMAL ISSN 1907-9850 ANALISIS VARIASI NUKLEOTIDA DAERAH D-LOOP DNA MITOKONDRIA PADA SATU INDIVIDU SUKU BALI NORMAL Ketut Ratnayani, I Nengah Wirajana, dan A. A. I. A. M. Laksmiwati Jurusan Kimia FMIPA Universitas

Lebih terperinci

ESTIMASI NILAI BREEDING BERAT BADAN DAN PRODUKSI TELUR PUYUH (COTURNIX COTURNIX JAPONICA) BERDASARKAN POLIMORFISME GEN GH

ESTIMASI NILAI BREEDING BERAT BADAN DAN PRODUKSI TELUR PUYUH (COTURNIX COTURNIX JAPONICA) BERDASARKAN POLIMORFISME GEN GH ESTIMASI NILAI BREEDING BERAT BADAN DAN PRODUKSI TELUR PUYUH (COTURNIX COTURNIX JAPONICA) BERDASARKAN POLIMORFISME GEN GH Jurusan Biologi, Fakultas Matematika dan Ilmu Pengetahuan Alam, Universitas Negeri

Lebih terperinci

ABSTRAK. OPTIMASI AMPLIFIKASI BAGIAN GEN parc DENGAN METODE PCR PADA ISOLAT Salmonella typhi DARI RUMAH SAKIT IMMANUEL BANDUNG PERIODE 2006

ABSTRAK. OPTIMASI AMPLIFIKASI BAGIAN GEN parc DENGAN METODE PCR PADA ISOLAT Salmonella typhi DARI RUMAH SAKIT IMMANUEL BANDUNG PERIODE 2006 ABSTRAK OPTIMASI AMPLIFIKASI BAGIAN GEN parc DENGAN METODE PCR PADA ISOLAT Salmonella typhi DARI RUMAH SAKIT IMMANUEL BANDUNG PERIODE 2006 Hadi Sumitro Jioe, 2008. Pembimbing I : Ernawati Arifin Giri Rachman,

Lebih terperinci

BAB V HASIL. Studi ini melibatkan 46 sampel yang terbagi dalam dua kelompok, kelompok

BAB V HASIL. Studi ini melibatkan 46 sampel yang terbagi dalam dua kelompok, kelompok 34 BAB V HASIL Studi ini melibatkan 46 sampel yang terbagi dalam dua kelompok, kelompok sampel hipospadia isolated (n=23) dan kelompok laki-laki normal (n=23). Karakteristik pasien hipospadia di Indonesia

Lebih terperinci

DAFTAR ISI DAFTAR TABEL... DAFTAR GAMBAR... DAFTAR LAMPIRAN...

DAFTAR ISI DAFTAR TABEL... DAFTAR GAMBAR... DAFTAR LAMPIRAN... DAFTAR ISI Bab Halaman DAFTAR TABEL... DAFTAR GAMBAR... DAFTAR LAMPIRAN... ix x xii I II III PENDAHULUAN 1.1 Latar Belakang... 1 1.2 Identifikasi Masalah... 2 1.3 Tujuan Penelitian... 2 1.4 Kegunaan Penelitian...

Lebih terperinci

DIAGRAM FILOGENIK HASIL SEKUENS BASA DNA MENGGUNAKAN PROGRAM MEGA-7 (MOLECULAR EVOLUTIONARY GENETICS ANALYSIS)

DIAGRAM FILOGENIK HASIL SEKUENS BASA DNA MENGGUNAKAN PROGRAM MEGA-7 (MOLECULAR EVOLUTIONARY GENETICS ANALYSIS) DIAGRAM FILOGENIK HASIL SEKUENS BASA DNA MENGGUNAKAN PROGRAM MEGA-7 (MOLECULAR EVOLUTIONARY GENETICS ANALYSIS) Harumi Yuniarti* ), Bambang Cholis S* ), Astri Rinanti** ) *) Jurusan Teknik Industri, Fakultas

Lebih terperinci

PENGEMBANGAN MARKA MOLEKULER DNA DALAM IDENTIFIKASI SEL GONAD IKAN GURAME (Osphronemus gouramy) DAN IKAN NILA (Oreochromis niloticus) MENGGUNAKAN PCR

PENGEMBANGAN MARKA MOLEKULER DNA DALAM IDENTIFIKASI SEL GONAD IKAN GURAME (Osphronemus gouramy) DAN IKAN NILA (Oreochromis niloticus) MENGGUNAKAN PCR PENGEMBANGAN MARKA MOLEKULER DNA DALAM IDENTIFIKASI SEL GONAD IKAN GURAME (Osphronemus gouramy) DAN IKAN NILA (Oreochromis niloticus) MENGGUNAKAN PCR MARLINA ACHMAD SEKOLAH PASCASARJANA INSTITUT PERTANIAN

Lebih terperinci

BAB I PENDAHULUAN. Multidrug resistant tuberculosis (MDR-TB) merupakan salah satu fenomena

BAB I PENDAHULUAN. Multidrug resistant tuberculosis (MDR-TB) merupakan salah satu fenomena BAB I PENDAHULUAN 1.1 Latar Belakang Multidrug resistant tuberculosis (MDR-TB) merupakan salah satu fenomena resistensi tuberkulosis ( TB). MDR-TB didefinisikan sebagai keadaan resistensi terhadap setidaknya

Lebih terperinci

I. PENDAHULUAN. Produksi kedelai di Indonesia pada tahun 2009 mencapai ton. Namun,

I. PENDAHULUAN. Produksi kedelai di Indonesia pada tahun 2009 mencapai ton. Namun, 1 I. PENDAHULUAN 1.1 Latar Belakang dan Masalah Produksi kedelai di Indonesia pada tahun 2009 mencapai 974.512 ton. Namun, pada tahun 2010 produksi kedelai nasional mengalami penurunan menjadi 907.031

Lebih terperinci

BAB IV HASIL DAN PEMBAHASAN. A. ISOLASI DNA GENOM PADI (Oryza sativa L.) KULTIVAR ROJOLELE,

BAB IV HASIL DAN PEMBAHASAN. A. ISOLASI DNA GENOM PADI (Oryza sativa L.) KULTIVAR ROJOLELE, BAB IV HASIL DAN PEMBAHASAN A. ISOLASI DNA GENOM PADI (Oryza sativa L.) KULTIVAR ROJOLELE, NIPPONBARE, DAN BATUTEGI Isolasi DNA genom padi dari organ daun padi (Oryza sativa L.) kultivar Rojolele, Nipponbare,

Lebih terperinci

Deteksi Kedelai Transgenik GTS 40-3-2 Tahan Herbisida Berbahan Aktif Glifosat Menggunakan PCR.

Deteksi Kedelai Transgenik GTS 40-3-2 Tahan Herbisida Berbahan Aktif Glifosat Menggunakan PCR. 1 Deteksi Kedelai Transgenik GTS 40-3-2 Tahan Herbisida Berbahan Aktif Glifosat Menggunakan PCR. RINGKASAN Oleh Linda Tri Sugesti Pada saat ini kedelai merupakan salah satu komoditas bernilai ekonomi tinggi

Lebih terperinci

VII. UJI EKSPRESI GEN TcAP1 (APETALA1 KAKAO) PADA TANAMAN MODEL. Abstrak

VII. UJI EKSPRESI GEN TcAP1 (APETALA1 KAKAO) PADA TANAMAN MODEL. Abstrak VII. UJI EKSPRESI GEN TcAP1 (APETALA1 KAKAO) PADA TANAMAN MODEL Abstrak Pada berbagai spesies termasuk kakao, gen AP1 (APETALA1) diketahui sebagai gen penanda pembungaan yang mengendalikan terbentuknya

Lebih terperinci

BAB 2 TINJAUAN PUSTAKA

BAB 2 TINJAUAN PUSTAKA 4 BAB 2 TINJAUAN PUSTAKA 2.1. Klasifikasi Markisa Markisa mula-mula disebut passion fruit. Menurut sejarah, tanaman markisa berasal dari daerah tropis Amerika Selatan, tepatnya di daerah Brazil, Venezuela,

Lebih terperinci

BAB IV HASIL DAN PEMBAHASAN

BAB IV HASIL DAN PEMBAHASAN BAB IV HASIL DAN PEMBAHASAN 4.1 Ciri-ciri Fenotip Sampel Ikan Cyprinid Uji 4.1.1 Ikan Mas Majalaya Sampel ikan mas Majalaya (MJ) didapatkan dari pembudidaya ikan mas di daerah Ibun, Majalaya, Jawa Barat.

Lebih terperinci

KERAGAMAN MOLEKULER DALAM SUATU POPULASI

KERAGAMAN MOLEKULER DALAM SUATU POPULASI KERAGAMAN MOLEKULER DALAM SUATU POPULASI EKO HANDIWIRAWAN Pusat Penelitian dan Pengembangan Peternakan Jalan Raya Pajajaran Kav E-59, Bogor 16151 ABSTRAK Variasi di dalam populasi terjadi sebagai akibat

Lebih terperinci

I. PENDAHULUAN. Kedelai (Glycine Max [L.] Merrill) merupakan tanaman pangan yang memiliki

I. PENDAHULUAN. Kedelai (Glycine Max [L.] Merrill) merupakan tanaman pangan yang memiliki I. PENDAHULUAN 1.1 Latar Belakang dan Masalah Kedelai (Glycine Max [L.] Merrill) merupakan tanaman pangan yang memiliki nilai gizi yang sangat tinggi terutama proteinnya (35-38%) hampir mendekati protein

Lebih terperinci

BAB I PENDAHULUAN. A.Latar belakang. orang yang sudah meninggal, kegunaan golongan darah lebih tertuju pada

BAB I PENDAHULUAN. A.Latar belakang. orang yang sudah meninggal, kegunaan golongan darah lebih tertuju pada 1 BAB I PENDAHULUAN A.Latar belakang Golongan darah sistem ABO yang selanjutnya disebut golongan darah merupakan salah satu indikator identitas seseorang. Pada orang hidup, golongan darah sering digunakan

Lebih terperinci

I. PENDAHULUAN. Management of Farm Animal Genetic Resources. Tujuannya untuk melindungi dan

I. PENDAHULUAN. Management of Farm Animal Genetic Resources. Tujuannya untuk melindungi dan I. PENDAHULUAN 1.1. Latar Belakang Perserikatan Bangsa Bangsa telah mendirikan FAO Global Strategy for the Management of Farm Animal Genetic Resources. Tujuannya untuk melindungi dan mengatur pemanfaatan

Lebih terperinci

Mengintip capaian kajian genetika pada Allium sp.

Mengintip capaian kajian genetika pada Allium sp. Mengintip capaian kajian genetika pada Allium sp. Penulis: Lina Herlina, MSi. (peneliti BB Biogen, Bogor) Tahukah anda, bahwa didunia saat ini terdapat sekitar 103 jenis (strain) bawang? Di mana dalam

Lebih terperinci

diregenerasikan menjadi tanaman utuh. Regenerasi tanaman dapat dilakukan baik secara orgnogenesis ataupun embriogenesis (Sticklen 1991; Zhong et al.

diregenerasikan menjadi tanaman utuh. Regenerasi tanaman dapat dilakukan baik secara orgnogenesis ataupun embriogenesis (Sticklen 1991; Zhong et al. PENDAHULUAN Perbaikan suatu sifat tanaman dapat dilakukan melalui modifikasi genetik baik dengan pemuliaan secara konvensional maupun dengan bioteknologi khususnya teknologi rekayasa genetik (Herman 2002).

Lebih terperinci

SKRIPSI. ANALISIS POPULASI GENETIK PASAK BUMI (Eurycoma longifolia Jack) BERDASARKAN PENANDA RAPD (Random Amplified Polymorphic DNA)

SKRIPSI. ANALISIS POPULASI GENETIK PASAK BUMI (Eurycoma longifolia Jack) BERDASARKAN PENANDA RAPD (Random Amplified Polymorphic DNA) SKRIPSI ANALISIS POPULASI GENETIK PASAK BUMI (Eurycoma longifolia Jack) BERDASARKAN PENANDA RAPD (Random Amplified Polymorphic DNA) Oleh: Ade Rosidin 10982008445 PROGRAM STUDI AGROTEKNOLOGI FAKULTAS PERTANIAN

Lebih terperinci

sehingga diharapkan dapat menghasilkan keturunan yang memiliki toleransi yang lebih baik dibandingkan tetua toleran (segregan transgresif).

sehingga diharapkan dapat menghasilkan keturunan yang memiliki toleransi yang lebih baik dibandingkan tetua toleran (segregan transgresif). PEMBAHASAN UMUM Sorgum merupakan salah satu tanaman serealia yang memiliki toleransi yang tinggi terhadap kekeringan sehingga berpotensi untuk dikembangkan di lahan kering masam di Indonesia. Tantangan

Lebih terperinci

HASIL DAN PEMBAHASAN. Kecamatan Terisi secara geografis terletak pada 108 o o 17 bujur

HASIL DAN PEMBAHASAN. Kecamatan Terisi secara geografis terletak pada 108 o o 17 bujur IV HASIL DAN PEMBAHASAN 4.1. Keadaan Umum Wilayah Penelitian Kecamatan Terisi secara geografis terletak pada 108 o 04-108 o 17 bujur timur dan 6 o 36-6 o 48 lintang selatan memiliki luas wilayah 174,22

Lebih terperinci

BAB II TINJAUAN PUSTAKA. banteng liar. Para ahli meyakini bahwa penjinakan tersebut telah dilakukan sejak

BAB II TINJAUAN PUSTAKA. banteng liar. Para ahli meyakini bahwa penjinakan tersebut telah dilakukan sejak BAB II TINJAUAN PUSTAKA 2.1 Gambaran Umum Sapi Bali Sapi bali (Bos Sondaicus) adalah sapi asli Indonesia hasil domestikasi banteng liar. Para ahli meyakini bahwa penjinakan tersebut telah dilakukan sejak

Lebih terperinci

IV. HASIL DAN PEMBAHASAN. fenotipe yang diamati menunjukkan kriteria keragaman yang luas hampir pada

IV. HASIL DAN PEMBAHASAN. fenotipe yang diamati menunjukkan kriteria keragaman yang luas hampir pada IV. HASIL DAN PEMBAHASAN 4.1 Hasil Penelitian Pada penelitian F 5 hasil persilangan Wilis x B 3570 ini ditanam 15 genotipe terpilih dari generasi sebelumnya, tetua Wilis, dan tetua B 3570. Pada umumnya

Lebih terperinci

IDENTIFIKASI GEN PENCIRI RESISTENSI GENETIK TERHADAP FLU BURUNG PADA AYAM SENTUL

IDENTIFIKASI GEN PENCIRI RESISTENSI GENETIK TERHADAP FLU BURUNG PADA AYAM SENTUL IDENTIFIKASI GEN PENCIRI RESISTENSI GENETIK TERHADAP FLU BURUNG PADA AYAM SENTUL (Identification of Marker Gene for Resistance to Avian Influenza in Sentul Chicken) T. SARTIKA, S. ISKANDAR dan S. SOPIYANA

Lebih terperinci

GENETIKA DASAR Rekayasa Genetika Tanaman. Definisi. Definisi. Definisi. Rekayasa Genetika atau Teknik DNA Rekombinan atau Manipulasi genetik

GENETIKA DASAR Rekayasa Genetika Tanaman. Definisi. Definisi. Definisi. Rekayasa Genetika atau Teknik DNA Rekombinan atau Manipulasi genetik Definisi GENETIKA DASAR Rekayasa Genetika Tanaman Oleh: Dr. Ir. Dirvamena Boer, M.Sc.Agr. HP: 081 385 065 359 e-mail: dirvamenaboer@yahoo.com Fakultas Pertanian, Universitas Haluoleo, Kendari Dipublikasi

Lebih terperinci

BAB IV HASIL DAN PEMBAHASAN. trimethylammonium bromide), tahap ekstraksi meliputi lisis sel, presipitasi dan

BAB IV HASIL DAN PEMBAHASAN. trimethylammonium bromide), tahap ekstraksi meliputi lisis sel, presipitasi dan BAB IV HASIL DAN PEMBAHASAN 4.1 Ekstraksi DNA Analisis DNA dimulai dengan melakukan ekstraksi DNA total dari tanaman pisang. Ekstraksi DNA menggunakan metode CTAB (cetyl trimethylammonium bromide), tahap

Lebih terperinci

STUDI AWAL PEMANFAATAN MARKA MOLEKULER RAPD UNTUK PENENTUAN KEBENARAN TIGA KULTIVAR NILAM

STUDI AWAL PEMANFAATAN MARKA MOLEKULER RAPD UNTUK PENENTUAN KEBENARAN TIGA KULTIVAR NILAM Bionatura-Jurnal Ilmu-ilmu Hayati dan Fisik ISSN 1411-0903 Vol. 16, No. 2, Juli 2014: 109-113 STUDI AWAL PEMANFAATAN MARKA MOLEKULER RAPD UNTUK PENENTUAN KEBENARAN TIGA KULTIVAR NILAM 2 Peneliti dan Pengajar

Lebih terperinci

KERAGAMAN GENETIK PANDAN ASAL JAWA BARAT BERDASARKAN PENANDA INTER SIMPLE SEQUENCE REPEAT

KERAGAMAN GENETIK PANDAN ASAL JAWA BARAT BERDASARKAN PENANDA INTER SIMPLE SEQUENCE REPEAT MAKARA, SAINS, VOL. 14, NO. 2, NOVEMBER 2010: 158-162 KERAGAMAN GENETIK PANDAN ASAL JAWA BARAT BERDASARKAN PENANDA INTER SIMPLE SEQUENCE REPEAT Sri Endarti Rahayu *) dan Sri Handayani Jurusan Biologi,

Lebih terperinci

ANALISIS KERAGAMAN GENETIK BEBERAPA POPULASI IKAN BATAK (Tor soro) DENGAN METODE RANDOM AMPLIFIED POLYMORPHISM DNA (RAPD) 1

ANALISIS KERAGAMAN GENETIK BEBERAPA POPULASI IKAN BATAK (Tor soro) DENGAN METODE RANDOM AMPLIFIED POLYMORPHISM DNA (RAPD) 1 ANALISIS KERAGAMAN GENETIK BEBERAPA POPULASI IKAN BATAK (Tor soro) DENGAN METODE RANDOM AMPLIFIED POLYMORPHISM DNA (RAPD) 1 (The Genetic Variation Analysis of Some Populations of Mahseer (Tor soro) Using

Lebih terperinci

BAB II TINJAUAN PUSTAKA. bagi sel tersebut. Disebut sebagai penghasil energi bagi sel karena dalam

BAB II TINJAUAN PUSTAKA. bagi sel tersebut. Disebut sebagai penghasil energi bagi sel karena dalam BAB II TINJAUAN PUSTAKA 2.1. Mitokondria Mitokondria merupakan salah satu organel yang mempunyai peranan penting dalam sel berkaitan dengan kemampuannya dalam menghasilkan energi bagi sel tersebut. Disebut

Lebih terperinci

III. HASIL DAN PEMBAHASAN

III. HASIL DAN PEMBAHASAN III. HASIL DAN PEMBAHASAN 3.1 HASIL 3.1.1 Isolasi Vibrio harveyi Sebanyak delapan isolat terpilih dikulturkan pada media TCBS yaitu V-U5, V-U7, V-U8, V-U9, V-U24, V-U27, V-U41NL, dan V-V44. (a) (b) Gambar

Lebih terperinci

YOHANES NOVI KURNIAWAN KONSTRUKSI DAERAH PENGKODE INTERFERON ALFA-2B (IFNα2B) DAN KLONINGNYA PADA Escherichia coli JM109

YOHANES NOVI KURNIAWAN KONSTRUKSI DAERAH PENGKODE INTERFERON ALFA-2B (IFNα2B) DAN KLONINGNYA PADA Escherichia coli JM109 YOHANES NOVI KURNIAWAN 10702026 KONSTRUKSI DAERAH PENGKODE INTERFERON ALFA-2B (IFNα2B) DAN KLONINGNYA PADA Escherichia coli JM109 Program Studi Sains dan Teknologi Farmasi INSTITUT TEKNOLOGI BANDUNG 2007

Lebih terperinci

DESAIN PRIMER SECARA IN SILICO UNTUK AMPLIFIKASI FRAGMEN GEN rpob Mycobacterium tuberculosis DENGAN POLYMERASE CHAIN REACTION (PCR)

DESAIN PRIMER SECARA IN SILICO UNTUK AMPLIFIKASI FRAGMEN GEN rpob Mycobacterium tuberculosis DENGAN POLYMERASE CHAIN REACTION (PCR) Desain Primer secara in silico untuk Amplifikasi Fragmen Gen rpob Mycobacterium tuberculosis DESAIN PRIMER SECARA IN SILICO UNTUK AMPLIFIKASI FRAGMEN GEN rpob Mycobacterium tuberculosis DENGAN POLYMERASE

Lebih terperinci

TINJAUAN PUSTAKA. Menurut Steenis (1950), klasifikasi tanaman aren sebagai berikut ini:

TINJAUAN PUSTAKA. Menurut Steenis (1950), klasifikasi tanaman aren sebagai berikut ini: TINJAUAN PUSTAKA Deskripsi Tanaman Aren Menurut Steenis (1950), klasifikasi tanaman aren sebagai berikut ini: Kingdom Filum Sub Filum Kelas Ordo Famili Genus Spesies : Plantae : Spermatophyta : Angiospermae

Lebih terperinci

BAB III BAHAN DAN METODE

BAB III BAHAN DAN METODE BAB III BAHAN DAN METODE 3.1. Tempat dan Waktu Penelitian 3.1.1. Tempat Penelitian Penelitian dilaksanakan di Laboratorium Bioteknologi Perikanan dan Kelautan Fakultas Perikanan dan Ilmu Kelautan Universitas

Lebih terperinci

BAB IV HASIL DAN PEMBAHASAN. 4.1 Kuantitas dan Kualitas DNA Udang Jari Hasil Isolasi

BAB IV HASIL DAN PEMBAHASAN. 4.1 Kuantitas dan Kualitas DNA Udang Jari Hasil Isolasi BAB IV HASIL DAN PEMBAHASAN 4.1 Kuantitas dan Kualitas DNA Udang Jari Hasil Isolasi Isolasi DNA merupakan langkah awal dalam analisis molekuler yang berbasis DNA. Tahapan ini sangat berperan penting dalam

Lebih terperinci

Aplikasi Marka Molekuler Terpaut Gen-gen Ketahanan Penyakit Hawar Daun Bakteri dalam Seleksi Tetua Persilangan

Aplikasi Marka Molekuler Terpaut Gen-gen Ketahanan Penyakit Hawar Daun Bakteri dalam Seleksi Tetua Persilangan Aplikasi Marka Molekuler Terpaut Gen-gen Ketahanan Penyakit Hawar Daun Bakteri dalam Seleksi Tetua Persilangan Dwinita W.Utami 1, E.M Septiningsih 2, S Yuriyah 1, I Hanarida 1 1 Balai Besar Penelitian

Lebih terperinci

I. PENDAHULUAN. perempuan di dunia dan urutan pertama untuk wanita di negara sedang

I. PENDAHULUAN. perempuan di dunia dan urutan pertama untuk wanita di negara sedang I. PENDAHULUAN Kanker serviks menduduki urutan kedua dari penyakit kanker yang menyerang perempuan di dunia dan urutan pertama untuk wanita di negara sedang berkembang (Emilia, dkk., 2010). Berdasarkan

Lebih terperinci