BAB VII PENGEMBANGAN MARKA SNAP BERBASIS RESISTANCE GENE ANALOGUE

Save this PDF as:
 WORD  PNG  TXT  JPG

Ukuran: px
Mulai penontonan dengan halaman:

Download "BAB VII PENGEMBANGAN MARKA SNAP BERBASIS RESISTANCE GENE ANALOGUE"

Transkripsi

1 BAB VII PENGEMBANGAN MARKA SNAP BERBASIS RESISTANCE GENE ANALOGUE (RGA) DAN DEFENSE GENE ANALOGUE (DGA) UNTUK KETAHANAN TERHADAP LAYU FUSARIUM PADA TANAMAN PISANG (Musa spp.) Abstrak Pengembangan kultivar pisang tahan penyakit secara konvensional menghadapi kendala lamanya waktu yang diperlukan untuk seleksi dan evaluasi tanaman hasil persilangan, oleh karena itu pendekatan bioteknologi melalui pengembangan marka molekuler merupakan salah metode alternatif yang dapat digunakan. Berdasarkan substitusi basa nukleotida (SNP) yang diidentifikasi pada fragmen resistance gene analogue (RGA), β-1,3-glucanase dan chitinase asal tanaman pisang, dikembangkan marka SNAP untuk seleksi ketahanan tanaman pisang terhadap penyakit. Tahapan penelitian meliputi (1) penentuan situs SNP asal gen MNBS, β-1,3-glucanase dan chitinase untuk pembuatan primer SNAP, (2) pembuatan primer spesifik alel, (3) pengujian efektifitas primer SNAP dalam mengamplifikasi produk PCR pada DNA genom pisang, (4) pengujian dan pemilihan primer SNAP untuk marka ketahanan terhadap FOC pada 10 kultivar referensi dan beberapa kultivar/aksesi pisang lainnya. Primer SNAP dibuat berdasarkan 14 sekuen MNBS, 4 sekuen β-1,3-glucanase dan 8 sekuen chitinase. Berdasarkan fragmen gen MNBS dihasilkan sebanyak 14 pasang primer SNAP dan 10 diantaranya terbukti efektif mengamplifikasi produk PCR pada kultivar Klutuk Wulung dan Barangan, sedangkan dari fragmen gen β-1,3-glucanase diperoleh 6 pasang primer dan 22 pasang primer dihasilkan dari fragmen gen chitinase. Semua pasangan primer asal fragmen gen β-1,3-glucanase dan chitinase telah terbukti efektif mengamplifikasi produk PCR. Berdasarkan hasil pengujian menggunakan kultivar referensi terpilih 2 pasang primer berdasarkan fragmen gen MNBS, 2 pasang primer berdasarkan fragmen gen β-1,3-glucanase dan 10 pasang primer berdasarkan fragmen gen chitinase, yang digunakan sebagai marka SNAP untuk ketahanan terhadap layu FOC. Marka SNAP tersebut berhasil mengelompokkan kultivar pisang berdasarkan karakter ketahanan terhadap FOC. Hasil penelitian ini merupakan langkah awal dalam pembuatan marka SNAP berdasarkan gen yang bertanggung jawab pada ketahanan dan pertahanan terhadap penyakit tanaman pisang. Kata kunci: Pisang, SNAP, marka molekuler, RGA, DGA, ketahanan penyakit 1 Bagian bab ini telah diterbitkan di Jurnal Hortikultura Vol. 23 No. 4 dengan judul: Pengembangan Marka SNAP Berbasis Resistance Geneanalogue (RGA) pada Tanaman Pisang (Musa spp.)

2 106 THE DEVELOPMENT OF SNAP MARKER FOR FUSARIUM WILT RESISTANCE BASED ON RESISTANCE GENE ANALOGUE (RGA) AND DEFENSE GENE ANALOGUE (DGA) ON BANANA (Musa spp.) Abstract The development of resistance banana cultivars through conventional breeding methods encounters some obstacles, because breeding program require a long time for selecting and evaluating of the new hybrids. Therefore, the support of biotechnology approaches and molecular markers in banana breeding will be beneficial. SNAP markers for banana disease resistance were developed based on SNPs identified from RGAs, β-1,3-glucanase dan chitinase genes isolated from banana. The activities include (1) the identification of putative SNPs from RGAs, β-1,3-glucanase dan chitinase genes for generating of SNAP primers, (2) allel specific primer design, (3) the evaluation of effectivity of primers on PCR reactions, (4) selection and evaluation of SNAP primers for FOC resistance marker using 12 banana cultivars. SNAP primers were generated based on 14 MNBS, 4 β-1,3-glucanase dan 8 chitinase sequences. Fourteen allelic specific primers were obtained from MNBS sequences and 10 of them were able to amplified PCR products from genomic DNA of banana cv. Klutuk Wulung and Barangan. Six allelic primers from β-1,3-glucanase gene and 22 primers from chitinase gene were effectively able to amplified PCR products from genomic DNA of the same banana cultivars. Two primers pairs based on MNBS sequences, 2 primers based on β-1,3-glucanase gene sequences, and 10 primers based on chitinase gene sequences were selected for SNAP marker for FOC resistance. This study was the initial effort of SNAP marker development using RGAs and defense genes and potentially can be used for banana disease resistance markers in general. Keywords: Banana, SNAP, molecular marker, RGA, DGA, disease resistance 1 Part of this chapter has been published in the Jurnal Hortikultura Vol. 23 No. 4, entitled: Pengembangan Marka SNAP Berbasis Resistance Gene Analogue (RGA) pada Tanaman Pisang (Musa spp.)

3 107 Pendahuluan Marka molekuler seperti RAPD (Howell et al.1994), RFLP (Faure et al. 1993), SSR (Crouch et al. 1998), ISSR (Venkatachalam et al. 2008) dan AFLP (Ude et al. 2002) telah digunakan sebagai alat untuk analisis genetik tanaman pisang. Marka RAPD dan SCAR telah digunakan sebagai indikator seleksi secara tidak langsung untuk ketahanan pisang terhadap penyakit bercak daun sigatoka (Nwauzoma et al. 2011) dan layu Fusarium (Wang et al. 2012). Single nucleotide polymorphism (SNP) adalah marka molekular generasi baru yang telah dikembangkan dan digunakan pada kedokteran, ternak dan tanaman (Gupta et al. 2001). Marka molekuler berbasis SNP telah mulai banyak digunakan untuk studi genotipe (Till et al. 2010), pembuatan peta tautan genetik beresolusi tinggi (Drenkard et al. 2000; Rabbi et al. 2012), identifikasi varietas ginseng (Sun et al. 2011), penentuan spesies dari kerabat jeruk (Jiang et al. 2010), identifikasi Canabis yang menghasilkan produk narkotika atau tidak (Rotherham & Harbison 2011), dan seleksi untuk karakter tertentu (MAS) dalam proses pemuliaan tanaman (Gupta et al. 2001). Metode identifikasi SNP yang masih sering digunakan untuk skala kecil adalah Cleaved Amplified Polymorphic Sequence (CAPS), derived CAPS (dcaps) (Thiel et al. 2004; Nasu et al. 2002) dan Allel Specific-PCR (AS-PCR) atau Single Nucleotide Amplified Polymorphism (SNAP) (Drenkard et al. 2000; Liu et al. 2012). Dalam aplikasinya marka CAPS dan dcaps mempunyai keterbatasan yaitu memerlukan enzim nuclease sehingga memerlukan biaya yang masih relatif tinggi, sedangkan marka AS-PCR atau SNAP hanya memerlukan pasangan primer dan teknik PCR dan elektroforesis gel agarose standar (Drenkard et al. 2000). Salah satu contoh pengembangan marka SNAP untuk marka yang berhubungan dengan karakter aroma dan supernodulasi pada tanaman kedelai (Kim et al. 2005; Juwattanasomran et al. 2011), sehingga proses seleksi yang berhubungan dengan kedua karakter tersebut bisa lebih cepat dan efisien. Secara umum penelitian yang dilakukan berusaha mengembangkan marka SNAP untuk seleksi tidak langsung sifat ketahanan tanaman pisang terhadap penyakit. Secara khusus penelitian yang dilakukan bertujuan untuk: (1) menentukan situs SNP non synonymous pada RGA dan DGA asal tanaman pisang untuk pengembangan marka SNAP, (2) mendisain pasangan primer spesifik alel untuk menghasilkan marka SNAP pada situs-situs SNP yang teridentifikasi, (3) mengevaluasi efektivitas pasangan primer yang didapat untuk menghasilkan marka SNAP, dan (4) mengevaluasi marka SNAP berasis RGA dan DGA sebagai marka ketahanan terhadap FOC pada beberapa kultivar pisang. Bahan dan Metode Waktu dan Tempat Kegiatan penelitian dilaksanakan mulai bulan November 2012 sampai Juli 2013, di laboratorium Pemuliaan dan Biologi Molekular Tanaman, Program Studi Agronomi dan Hortikultura, Fakultas Pertanian, Institut Pertanian Bogor.

4 108 Bahan Penelitian dan Isolasi DNA Pengujian efektivitas primer SNAP dilakukan menggunakan DNA genom yang diisolasi dari daun pisang cv. Klutuk Wulung (BB) dan Barangan (AAA). Penentuan primer SNAP untuk marka ketahanan terhadap penyakit layu FOC, digunakan DNA genom asal kultivar pisang yang mempunyai ketahanan terhadap FOC yang bervariasi sebagai kultivar referensi. Sebagian kultivar yang digunakan sebagai referensi adalah kultivar yang telah diuji ketahanannya terhadap penyakit layu FOC pada Percobaan 1, dan sebagian lagi berdasarkan informasi hasil penelitian sebelumnya (Molina et al. 2010). Untuk tanaman sangat rentan sampai rentan digunakan kultivar Barangan, Ambon Kuning dan Ambon Hijau. Kultivar yang mewakili rentan sampai tahan adalah Ketan, Kepok, Jawaka dan Awak, sedangkan yang mewakili kultivar tahan sampai sangat tahan adalah Calcuta, Rejang dan Klutuk Wulung. Pengujian marka SNAP selanjutnya dilakukan pada 10 kultivar/aksesi yang belum diketahui ketahanannya, yang mewakili spesies liar M. acuminata: HlbS, Slk-29 dan yang kultivar, yaitu: MDO-01, MDO-04, MLU-07, SUM-01, SUM-04, HyKC-01 dan Muli, serta seksi Australimusa AMB-01. Bahan tanaman yang digunakan adalah daun muda dan isolasi DNA berdasarkan metode CTAB (Doyle & Doyle 1987) yang dimodifikasi oleh Das et al. (2009). Selanjutnya stok DNA disimpan dalam lemari pendingin bersuhu -20 C sampai siap digunakan. Identifikasi Situs SNP yang Non-synonymous Diantara sejumlah situs SNP yang teridentifikasi, dipilih situs SNP pada coding region yang menyebabkan terjadinya perubahan residu asam amino atau disebut non-synonymous. Identifikasi situs SNP yang nonsynonymous berbasis RGA dilakukan pada sekuen DNA dari 14 fragmen RGA asal tanaman pisang (MNBS) yang telah diisolasi dari Percobaan 2, sedangkan SNP berbasis DGA dilakukan pada sekuen chitinase hasil dari Percobaan 3, dan sekuen β-1,3-glucanase hasil dari Percobaan 4. Identifikasi situs SNP dengan melakukan pensejajaran sekuen DNA dan prediksi asam amino dari menggunakan perangkat lunak Geneious Pro versi percobaan (Biomatters, USA). Disain Primer Spesifik Alel untuk Marka SNAP Pasangan primer SNAP didisain berdasarkan situs SNP terpilih dengan menggunakan perangkat lunak WebSNAPER yang tersedia di situs Ketika mengakses situs tersebut, pada layar WebSNAPER dipilih menu SNAP Program. Pengguna program yang baru pertama kali mengakses harus melakukan Sign in dan memasukkan alamat pengguna pada tempat yang tersedia. Setelah Sign in, muncul kotak dialog (Gambar 1) untuk memasukkan runutan nukleotida dengan situs SNP target yang dievaluasi. Situs SNP target ditandai sebagai [X/Y], dimana X adalah nukleotida untuk alel referensi dan Y adalah nukleotida untuk alel alternatif. Beberapa parameter yang perlu diisi/disesuaikan adalah ukuran produk amplifikasi PCR, suhu TM dan nama primer yang diinginkan. Screen shot perangkat lunak WebSNAPER dan sejumlah isian yang perlu diisi terkait dengan disain marker SNAP disajikan pada Gambar 33.

5 109 Gambar 33 Tampilan perangkat lunak WebSNAPER yang digunakan untuk mendisain primer SNAP. Runutan nukleotida yang diberi lingkaran adalah posisi single nucleotide polymorphism (SNP) yang digunakan. Setelah semua parameter terisi (Gambar 33), perangkat lunak diaktifkan dengan menekan tombol Submit!. Perangkat lunak WebSNAPER mengirimkan hasil analisisnya dalam bentuk pesan elektronik ke alamat pengguna, yang selanjutnya dapat dikonversi dan dibaca dengan menggunakan perangkat lunak pengolah kata. Proses disain primer tersebut diulang kembali untuk setiap posisi SNP pada runutan DNA yang diinginkan. Selanjutnya dari masing-masing hasil analisis untuk setiap situs SNP akan dipilih satu set (4) primer yang terdiri atas sepasang primer untuk alel referensi dan sepasang primer yang lain untuk alel alternatif. Setelah runutan primer diperoleh dan dipilih sesuai dengan jumlah situs SNP, primer disintesis dengan menggunakan perusahaan jasa pembuatan primer. Evaluasi Efektivitas Primer SNAP Untuk menentukan posisi SNP mana saja yang dapat digunakan untuk menghasilkan marka SNAP, setelah disain primer dan pemesanan primer diselesaikan, primer SNAP yang didapat diuji kemampuannya untuk menghasilkan produk amplifikasi dengan menggunakan cetakan DNA genom pisang. Dalam penelitian ini, pengujian efektivitas primer SNAP dilakukan dengan menggunakan DNA genom pisang cv. Klutuk Wulung dan Barangan. Reaksi PCR dilaksanakan dengan volume 25 µl menggunakan KAPA2G TM PCR Kit (Kapa Biosystems Inc., USA), yang komposisinya terdiri atas 5.0 µl 5 X buffer PCR (di dalamnya terkandung 1.5 mm Mg 2+ ), 0.5 µl MgCl 2 25 mm, 0.5 µl dntps 10 mm, 1.0 µl masing-masing primer dengan konsentrasi 10 µm (primer forward dan reverse), 30 ng DNA genom, 0.1 µl Taq DNA polymerase (5 U µl -1 ) dan 15.4 µl ddh 2 O. Proses PCR menggunakan mesin GeneAmp PCR System

6 (Perkin Elmer). Denaturasi cetakan DNA pada awal reaksi pada suhu 95 C selama 3 menit, diikuti dengan 35 kali siklus 95 C selama 10 detik, 60 sampai 62 C selama 10 detik dan 72 C selama 3 detik, dan diakhiri dengan satu siklus 72 C selama 10 menit. Produk PCR dipisahkan berdasarkan ukuran dengan menggunakan elektroforesis gel agarose 1 % pada mesin elektroforesis dengan tegangan 80 V selama 25 menit. Analisis Data Berdasarkan hasil elektroferogram, data keberadaan pita amplifikasi dikonversi menjadi data binary untuk membuat data genotipe. Bila dalam satu lokus hanya primer reference yang menghasilkan produk amplifikasi, disandi dengan , bila hanya primer alternate yang menghasilkan produk, disandi dengan , sedangkan bila kedua primer menghasilkan produk disandi dengan Selanjutnya dari data genotipe yang diperoleh, dilakukan analisis filogenetik menggunakan perangkat lunak NTSYS ver 2.02 (Exeter Software, New York, USA). Hasil dan Pembahasan Single nucleotide polymorphism (SNP) adalah polimorfisme yang disebabkan oleh proses substitusi satu basa pada nukleotida dalam genom tanaman (Syvänen 2001). Keberadaan SNP diketahui menyebar di seluruh bagian dari genom tanaman sehingga berpotensi untuk digunakan sebagai marka molekuler (Gupta et al. 2001). Identifikasi Situs SNP yang Non-synonymous SNP berbasis sekuen RGA. Fragmen MNBS yang digunakan dalam penelitian ini berukuran 524 pasang basa (pb). Seluruh runutan nukleotida MNBS tersebut merupakan bagian exon dan tidak terdapat intron di dalamnya. Fragmen MNBS menyandi 174 asam amino yang merupakan bagian dari domain motif p-loop sampai dengan GLPL. Berdasarkan hasil pensejajaran runutan DNA diantara 14 MNBS, berhasil diidentifikasi keberadaan 30 situs SNP. Nukleotida pada urutan nomor 215 merupakan situs SNP dengan varian nukleotida [G/A]. Pada posisi tersebut, keberadaan SNP menyebabkan terjadinya substitusi residu asam amino dari arginin (R) menjadi lisin (K) (Gambar 34). Situs SNP seperti pada posisi 215 yang dipilih untuk pengembangan marka SNAP dalam tahap-tahap penelitian selanjutnya. Dari 30 situs SNP yang berhasil diidentifikasi pada fragmen MNBS, diperoleh 20 situs SNP yang menyebabkan terjadinya substitusi asam amino. Selanjutnya, 20 situs SNP tersebut dipilih untuk mendisain pasangan primer SNAP. Meskipun tergolong menyebabkan substitusi residu asam amino, belum tentu dari setiap situs SNP yang terpilih dapat didisain pasangan primer SNAP, karena tidak semua situs bisa menghasilkan pasangan primer. Kegagalan mendisain primer dari situs yang teridentifikasi antara lain disebabkan oleh kurangnya jumlah basa di sekitar situs SNP terutama untuk situs SNP ada di ujung 5 ataupun 3 runutan nukleotida fragmen DNA yang digunakan atau karena komposisi nukleotida di sekitar target SNP tidak dapat memenuhi kriteria yang ditentukan di awal proses disain primer.

7 NT AA Gambar 34 Representasi situs SNP pada fragmen MNBS asal pisang (Musa spp.). Situs SNP 195 dan 225 tidak menyebabkan terjadinya substitusi asam amino sedangkan situs SNP 215 merubah residu asam amino arginin menjadi lisin. NT: runutan nukleotida DNA dan AA: runutan asam amino yang diprediksi dari runutan NT, segitiga merah: posisi SNP. Gambar 35 Representasi situs SNP pada fragmen MNBS. Situs SNP dengan latar belakang kuning adalah situs SNP yang menyebabkan terjadinya substitusi asam amino sedangkan situs SNP di dalam kotak merah adalah situs SNP terpilih untuk pembuatan primer SNAP. Nomor di atas runutan DNA mengindikasikan posisi nukleotida dalam fragmen MNBS. EU dan EU adalah RGA asal Musa yang terdeposit dalam GenBank NCBI. Untuk mendisain primer, di sekitar situs SNP disyaratkan keberadaan sebanyak minimal 25 nukleotida. Selain itu untuk mengkonfirmasi apakah situs SNP teridentifikasi benar-benar SNP atau kesalahan proses sekuensing (sequencing error), dalam pemilihan SNP perlu dilibatkan juga aksesi dari gen serupa yang diambil dari GenBank. Untuk mendisain primer spesifik alel, dari alternatif 20 situs SNP pada

8 112 fragmen MNBS, hanya 8 situs SNP saja yang dipilih (Gambar 35). SNP berbasis sekuen β-1,3-glucanase. Analisis pensejajaran 4 sekuen MaGlu yang berukuran 788 pb yang diperoleh dalam penelitian ini menemukan adanya 8 SNP, tetapi hanya 4 SNP yang menyebabkan perubahan asam amino atau non-synonymous SNP, yaitu nukleotida pada urutan nomor 91, 538, 677 dan 778. Keberadaan situs SNP ditampilkan pada Gambar 36. SNP berbasis sekuen gen chitinase. Berdasarkan analisis pensejajaran 8 sekuen gen MaChi yang berukuran 596 pb yang diperoleh dalam penelitian ini ditemukan sebanyak 22 situs SNP pada coding region dan 6 situs SNP pada noncoding region. Namun demikian hanya 14 situs SNP yang menyebabkan substitusi 11 residu asam amino (Gambar 37), dan 11 situs di antaranya digunakan untuk mendisain primer SNAP. [G/C] [A/C] [A/G] [C/A] MaGlu_Klt : MaGlu_Rjg: MaGlu_AH : MaGlu_Br : NT AA Gambar 36 Keberadaan situs SNP pada fragmen MaGlu asal pisang (Musa spp.). Situs SNP 30, 480, 618 dan 753 tidak menyebabkan terjadinya substitusi residu asam amino sedangkan situs SNP 91, 538, 677 dan 778 yang dapat merubah residu asam amino (segitiga merah). NT: runutan nukleotida DNA dan AA: runutan asam amino yang diprediksi dari runutan NT. Huruf di atas segitiga merah adalah varian nukleotida pada situs non-synonymous SNP. Gambar 37 Representasi situs SNP pada fragmen gen MaChi dari 5 kultivar pisang. MaChi-Rjg asal Rejang, MaChi_Klt#1 & #2 asal Klutuk Wulung, MaChi_Kpk#1 & #2 asal Kepok, MaChi_AH#1 & #2 asal Ambon Hijau, dan MaChi_Br asal Barangan. Tanda bintang di bawah sekuen adalah posisi SNP, dan angka di atas sekuen adalah posisi basa nukleotida dalam fragmen MaChi asal DNA genom. Basa nukleotida dalam kotak adalah SNP yang digunakan untuk mengembangkan marka SNAP.

9 Tabel 22 Primer alternatif sebagai luaran yang didapat dari proses mendisain primer dengan menggunakan WebSNAPER untuk situs SNP1 dari fragmen gen MNBS Identitas primer Runutan nukleotida Tm ( C) Panjang (pb ) Produk PCR (pb) Catatan peringatan SNP1_MNBS_L_REF_1 CCGCGATTA ACCATGTGGTGCTCA SNP1_MNBS_L_REF_1_REV GCAGGGCA ATCTCCATGGGCTC SNP1_MNBS_L_REF_2 CCCGCGATT TTACCATGTGGTGTTCA SNP1_MNBS_L_REF_2_REV GCAGGGCA ATCTCCATGGGCTC SNP1_MNBS_L_REF_3 CCCGCGATT TTACCATGTGGTGAACA SNP1_MNBS_L_REF_3_REV GCAGGGCA ATCTCCATGGGCTC SNP1_MNBS_L_REF_4 CCGCGATTA ACCATGTGGTGGTCA SNP1_MNBS_L_REF_4_REV GCAGGGCA ATCTCCATGGGCTC SNP1_MNBS_L_REF_5 CCGCGATTA ACCATGTGGTGAGCA SNP1_MNBS_L_REF_5_REV GCAGGGCA ATCTCCATGGGCTC SNP1_MNBS_L_ALT_1 * CCGCGATTA ACCATGTGGTGATGC High end self SNP1_MNBS_L_ALT_1_REV GCAGGGCA ATCTCCATGGGCTC complementarity SNP1_MNBS_L_ALT_2 * CCGCGATTA ACCATGTGGTGAACC High end self SNP1_MNBS_L_ALT_2_REV GCAGGGCA ATCTCCATGGGCTC complementarity SNP1_MNBS_L_ALT_3 CCGCGATTA ACCATGTGGTGAGCC SNP1_MNBS_L_ALT_3_REV GCAGGGCA ATCTCCATGGGCTC SNP1_MNBS_L_ALT_4 CCGCGATTA ACCATGTGGTGACCC SNP1_MNBS_L_ALT_4_REV GCAGGGCA ATCTCCATGGGCTC SNP1_MNBS_L_ALT_5 CCGCGATTA ACCATGTGGTGTTCC SNP1_MNBS_L_ALT_5_REV GCAGGGCA ATCTCCATGGGCTC SNP1_MNBS_L_ALT_6 CCGCGATTA ACCATGTGGTGGTCC SNP1_MNBS_L_ALT_6_REV GCAGGGCA ATCTCCATGGGCTC SNP1_MNBS_L_ALT_7 CCGCGATTA ACCATGTGGTGCTCC SNP1_MNBS_L_ALT_7_REV GCAGGGCA ATCTCCATGGGCTC Keterangan: nukleotida yang diberi garis bawah padaa primer forward adalah mismatch. Primer yang yang diberi tanda asterik [*] tidak dipilih untuk menghasilkan marka SNAP karena high end self complementarity

10 114 Disain Primer untuk Marka SNAP Pada Tabel 22 disajikan contoh luaran dari tahapan disain primer SNAP menggunakan perangkat lunak WebSNAPER. Contoh luaran hasil analisis situs SNP posisi #1 tersebut telah dikonversi ke dalam bentuk tabel. Dalam disain primer SNAP dengan menggunakan WebSNAPER, dari satu situs SNP dapat diperoleh sejumlah alternatif pasangan primer untuk menghasilkan marka SNAP. Sebagai contoh, untuk SNP yang dievaluasi posisi #1 telah dihasilkan 12 pilihan pasangan primer SNAP (5 pasang primer reference dan 7 pasang primer alternate) seperti yang ditampilkan pada Tabel 22. Namun demikian 2 primer alternate tidak bisa dipilih karena berpotensi membentuk utas ganda antar pasangan primer (high end self complementarity), yaitu pasangan primer SNP1_MNBS_L_ALT_1 dan SNP1_MNBS_L_ALT_2. Selanjutnya dari 12 alternatif primer yang dihasilkan, hanya akan dipilih sepasang primer untuk alel referensi dan sepasang primer untuk alel alternatif. Salah satu hal penting dalam pemilihan primer SNAP adalah Tm. Pasangan primer harus mempunyai Tm yang tidak jauh berbeda. Pada Tabel 22 terlihat bahwa terdapat satu nukleotida yang berbeda selain pada situs SNP-nya (ujung 3 ) dari primer forward terhadap sekuen aslinya, yang disebut mismatch. Posisi mismatch bisa berjarak satu sampai 4 nukleotida dari situs SNP. Untuk lebih jelasnya bisa dilihat pada Gambar 38 yang menunjukkan pensejajaran runutan nukleotida semua primer forward dari Tabel 22 dengan fragmen aslinya (MNBS). Menurut Bru et al. (2008), posisi mismatch dari ujung 3 sangat berpengaruh terhadap keberhasilan mendapatkan produk PCR. Semakin dekat mismatch dengan ujung 3 semakin besar kegagalan mendapat produk PCR. Berdasarkan hal tersebut, maka primer SNAP yang dipilih adalah yang mempunyai posisi mismatch dengan jarak paling jauh dari ujung. Gambar 38 adalah contoh pensejajaran runutan nukleotida primer forward untuk SNP1 dari Tabel 22 terhadap fragmen MNBS untuk melihat jarak nukleotida mismatch terhadap ujung 3 (situs SNP1). Berdasarkan hasil disain primer SNAP, dari 8 situs SNP fragmen MNBS yang dipilih, satu situs SNP (posisi #215) tidak menghasilkan primer SNAP karena primer yang didapat mempunyai peluang membentuk utas ganda dengan dirinya sendiri pada ujung-ujungnya (high end self complementarity). Hal ini dapat mengakibatkan terbentuknya hairpin atau terbentuknya primer dimer sehingga berpotensi mengganggu amplifikasi fragmen target dan produk PCR yang diinginkan tidak dapat dihasilkan (Brownie et al. 1997). Gambar 38 Pensejajaran runutan nukleotida dari alternatif primer untuk situs SNP#1 dengan fragmen MNBS. Tanda segitiga hitam adalah situs SNP#1 dan segitiga putih adalah posisi mismatch terjauh dari ujung 3 primer yang didapat.

11 Tabel 23 Primer SNAP terpilih dari 7 situs SNP asal fragmen gen MNBS yang dapat digunakan untuk menghasilkan marka SNAP SNP Identitas primer Sekuen primer forward (5-3 ) Sekuen primer reverse (5-3 ) Suhu TM (ºC) Produk (pb) 1 SNP1_MNBS_Ref CCGCGATTACCATGT TGGTGCTCA GCAGGGCATCTCCATGGGCTC SNP1_MNBS_Alt CCGCGATTACCATGT TGGTGCTCC GCAGGGCATCTCCATGGGCTC SNP2_MNBS_Ref GGCGAGGATCAGCTT TCCACCCTTT GGTGATCATGATCGAGGTTGCCAACT SNP2_MNBS_Alt GGCGAGGATCAGCTT TCCACCCTTA GGTGATCATGATCGAGGTTGCCAACT SNP3_MNBS_Ref GCGAGGCGAGGATCA AGATTC GGAATGGGGAAAACGACGCT SNP3_MNBS_Alt GCGAGGCGAGGATCA AGATTA GGAATGGGGAAAACGACGCT SNP4_MNBS_Ref TGGTTCGACCGCGAG GGCCAG GGAATGGGGAAAACGACGCTCCT SNP4_MNBS_Alt TGGTTCGACCGCGAG GGCCAC GGAATGGGGAAAACGACGCTCCT SNP5_MNBS_Ref AACCTCAGCGATTCA ATTGGCGC ATGCAGAAGATCATCGCCAATCGG SNP5_MNBS_Alt ACAACCTCAGCGATT TCATTGGCGT ATGCAGAAGATCATCGCCAATCGG SNP6_MNBS_Ref CGGAACAACCTCAGC CGATTCCTTG GGTGATCATGATCGAGGTTGCCAACT SNP6_MNBS_Alt CCGGAACAACCTCAG GCGATTCACTC GGTGATCATGATCGAGGTTGCCAACT SNP7_MNBS_Ref CTGTATGATATCCAT TGGCGGTTC ATGCAGAAGATCATCGCCAATC SNP7_MNBS_Alt TCTGTATGATATCCA ATGGCGGTTT ATGCAGAAGATCATCGCCAATC Keterangan: Nukleotida yang diberi garis bawah adalah mismatch Tabel 24 Primer SNAP terpilih dari 3 situs SNP asal fragmen gen β-1,3-glucanase yang dapat digunakan untuk menghasilkan marka SNAP SNP Identitas primer Sekuen primer forward (5-3 ) Sekuen primer reverse (5-3 ) Suhu TM (ºC) Produk (pb) 1 SNP1_MGlu_Ref GGATGTCCCCCGATCCGTCG TTACTCGCCAAGAACTGCACGATGG SNP1_MGlu_Alt GGATGTCCCCCGATCCGTCC TTACTCGCCAAGAACTGCACGATGG SNP2_MGlu_Ref CGATGGCGTCGAACAGGTGCTT TACATCCTCCCCGCCATGCG SNP2_MGlu_Alt GACGATGGCGTCGAACAGGTTTTG TACATCCTCCCCGCCATGCG SNP3_MGlu_Ref GCCTGATCAAGTTCTGGTTGTACGCCT GCCCAGGCGTACCTGAGCCC SNP3_MGlu_Alt CCTGATCAAGTTCTGGTTGTACGGCC GCCCAGGCGTACCTGAGCCC Keterangan: Nukleotida yang diberi garis bawah adalah mismatch

12 Tabel 25 Primer SNAP terpilih dari 11 situs SNP asal fragmen gen chitinase yang dapat digunakan untuk menghasilkan marka SNAP SNP Identitas primer Sekuen primer forward (5-3 ) Sekuen primer reverse (5-3 ) 1 SNP1_Mchi_Ref GCGTGGGGTTACTGCTTCGTCA GTGGTGACACCGTAGCCCGGAA SNP1_Mchi_Alt GCGTGGGGTTACTGCTTCGTCC GTGGTGACACCGTAGCCCGGAA 2 SNP2_Mchi_Ref CGCGTGGGGTTACTGCTTCATGAG GTGGTGACACCGTAGCCCGGAA SNP2_Mchi_Alt CGCGTGGGGTTACTGCTTCATGAC GTGGTGACACCGTAGCCCGGAA 3 SNP3_Mchi_Ref GCGTGGGGTTACTGCTTCATCGGT GTGGTGACACCGTAGCCCGGAA SNP3_Mchi_Alt CGTGGGGTTACTGCTTCATCGGG GTGGTGACACCGTAGCCCGGAA 4 SNP4_Mchi_Ref GGGGTTACTGCTTCATCAGTGCACG GTGGTGACACCGTAGCCCGGAA SNP4_Mchi_Alt TGGGGTTACTGCTTCATCAGTGCACA GTGGTGACACCGTAGCCCGGAA 5 SNP5_Mchi_Ref CTTCATCAGTGAACGGAACCGCC GTGGTGACACCGTAGCCCGGAA SNP5_Mchi_Alt GCTTCATCAGTGAACGGAACCGCT GTGGTGACACCGTAGCCCGGAA 6 SNP6_Mchi_Ref CATCAGTGAACGGAACCCCCAAAA GTGGTGACACCGTAGCCCGGAA SNP6_Mchi_Alt TCATCAGTGAACGGAACCCCCAAAC GTGGTGACACCGTAGCCCGGAA 7 SNP7_Mchi_Ref CCCAAAGGACTACTGCGTCGCAAA GTGGTGACACCGTAGCCCGGAA SNP7_Mchi_Alt CCCAAAGGACTACTGCGTCGCAAG GTGGTGACACCGTAGCCCGGAA 8 SNP8_Mchi_Ref GGTGGCCACCAGGTCTGGGATC CGGCTTTCTTGGCCCAGTTATCTCA SNP8_Mchi_Alt GTGGCCACCAGGTCTGGGATG CGGCTTTCTTGGCCCAGTTATCTCA 9 SNP9_Mchi_Ref CGACGGCTTGGGCGACTCAGT CGCGTGGGGTTACTGCTTCATCA SNP9_Mchi_Alt GACGGCTTGGGCGACTGTGG CGCGTGGGGTTACTGCTTCATCA 10 SNP10_Mchi_Ref CGGCGTTGGTTGGCTTTCAA TGCGCTGCAGGCAAGAAATACTACG SNP10_Mchi_Alt CGGCGTTGGTTGGCTTCGAC TGCGCTGCAGGCAAGAAATACTACG 11 SNP11_Mchi_Ref CCGGTCGGCGTTGGTTGTCT TGCGCTGCAGGCAAGAAATACTACG SNP11_Mchi_Alt CCGGTCGGCGTTGGTTGGTG TGCGCTGCAGGCAAGAAATACTACG Keterangan: Nukleotida yang diberi garis bawah adalah mismatch Suhu TM (ºC) Produk (pb)

13 117 Disain primer menggunakan 7 situs SNP menghasilkan total 64 alternatif primer SNAP. Untuk setiap situs SNP diperlukan 2 pasangan primer, yang terdiri atas sepasang primer forward dan reverse untuk alel referensi dan sepasang primer forward dan reverse untuk alel alternatifnya. Dengan demikian, dari 7 situs SNP pada fragmen gen MNBS, dihasilkan 14 pasang primer SNAP seperti yang ditampilkan pada Tabel 23. Cara yang sama dalam mendisain primer SNAP untuk fragmen gen MNBS juga diterapkan untuk mendisain primer SNAP fragmen gen β-1,3- glucanase (MaGlu) dan chitinase (MaChi). Di dalam fragmen gen β-1,3- glucanase (MaGlu) dari 4 situs SNP yang menyebabkan substitusi residu asam amino, hanya 3 situs yang dipilih untuk mendisain primer SNAP. Satu situs SNP yang berada pada urutan nukleotida nomor 778 tidak dapat digunakan untuk mendisain primer SNAP, karena letaknya terlalu dekat dengan ujung dari fragmen MaGlu (berjarak 9 basa nukleotida), sehingga tidak memenuhi kriteria untuk perancangan primer SNAP menggunakan WebSNAPER. Untuk mendisain primer, di sekitar situs SNP disyaratkan keberadaan sebanyak minimal 25 basa nukleotida. Berdasarkan 3 situs SNP yang digunakan untuk mendisain primer, diperoleh 22 alternatif pasangan primer SNAP. Berdasarkan beberapa kriteria dalam pemilihan primer seperti yang telah dijelaskan sebelumnya, dipilih 6 pasang primer SNAP untuk 3 situs SNP yang terdapat dalam fragmen MaGlu. Pasangan primer terpilih ditampilkan pada Tabel 24. Di dalam fragmen gen chitinase (MaChi), dari 14 situs SNP yang teridentifikasi dipilih 11 situs SNP yang digunakan untuk merancang primer SNAP. Disain primer menggunakan 11 situs SNP menghasilkan total 124 alternatif pasangan primer SNAP. Berdasarkan kriteria tertentu dalam pemilihan primer seperti yang dijelas sebelumnya pada perancangan primer SNAP untuk RGA, diperoleh 22 pasang primer untuk 11 situs SNP yang teridentifikasi pada fragmen gen chitinase, seperti yang ditampilkan pada Tabel 25. Evaluasi Efektivitas Primer SNAP untuk Menghasilkan Marka Kemampuan primer SNAP yang dikembangkan untuk menghasilkan marka SNAP dengan menggunakan genom tanaman pisang perlu dievaluasi. Untuk evaluasi primer dalam penelitian, dari 14 pasangan primer SNAP yang dihasilkan berdasarkan fragmen gen MNBS, ini hanya dievaluasi 10 pasang primer SNAP. Pada Gambar 39 disajikan hasil PCR yang dilakukan dengan menggunakan 10 pasang primer SNAP dan DNA genom pisang cv. Klutuk Wulung atau Barangan. Produk amplifikasi PCR difragmentasi menggunakan teknik elektroforesis gel agarose, di-staining dengan ethidium bromide (EtBr), dan divisualisasi di bawah penyinaran UV. Berdasarkan elektroferogram (Gambar 39), pasangan primer yang diuji mampu menghasilkan produk PCR. Semua pasangan primer yang diuji menghasilkan produk PCR pada kedua pisang Klutuk Wulung dan Barangan yang diuji. Untuk primer SNP6_MNBS_Alt, hasil PCR-nya negatif dan tidak ada produk PCR ketika diuji menggunakan genom pisang Barangan. Hal tersebut menunjukkan bahwa pada Klutuk Wulung 5 lokus SNP yang diuji mempunyai kombinasi alel heterozigot, sedangkan pada Barangan, 4 lokus SNP mempunyai kombinasi alel heterozigot dan satu lokus homozigot (lokus SNP6_MNBS).

14 118 SNP1_MNBS SNP2_MNBS SNP4_MNBS SNP5_MNBS SNP6_MNBS A. R A R A R A R A R A B. Gambar 39 Produk PCR hasil amplifikasi dari genom tanaman pisang cv. Klutuk Wulung (A) dan Barangan (B) menggunakan 10 pasang primer SNAP berdasarkan situs SNP pada gen MNBS. R= primer reference, A= primer alternate Produk PCR hasil amplifikasi menggunakan 6 pasang primer SNAP yang dihasilkan untuk fragmen gen MaGlu terhadap DNA genom kultivar Klutuk Wulung dan Barangan ditampilkan pada Gambar 40. Berdasarkan hasil PCR menggunakan DNA genom pisang kultivar Klutuk Wulung dan Barangan sebagai cetakan DNA, semua pasang primer (6 pasang) yang didisain berdasarkan 3 situs SNP dari fragmen MaGlu yang diperoleh dari penelitian ini, mampu menghasilkan produk PCR. Berdasarkan hasil elektroferogram (Gambar 40) terlihat pasangan primer SNP1_MGlu_Ref memberikan hasil negatif pada kultivar Klutuk Wulung, tetapi hasil positif pada kultivar Barangan. Hasil sebaliknya diperoleh apabila menggunakan pasangan primer SNP1_MGlu_Alt. Hal ini menunjukkan lokus SNP1_MGlu kedua kultivar tersebut mengandung alel homozigot, dan sesuai dengan situs SNP yang teridentifikasi pada masing-masing kultivar (Gambar 39). Primer SNP1_MGlu_Ref adalah primer yang mengamplifikasi fragmen MaGlu yang mengandung nukleotida G sebagai situs SNP1 pada nukleotida nomor 91, yang terdapat pada Barangan, sedangkan primer SNP1_MGlu_Alt mengamplifikasi fragmen yang mengandung nukleotida C (nukleotida nomor 91) pada Klutuk Wulung. Semua pasangan primer SNP2_MGlu dan SNP3_MGlu (reference dan alternate) menghasilkan produk PCR pada kedua kultivar yang diuji. Hal ini menunjukkan baik pada Klutuk Wulung maupun Barangan, kedua lokus tersebut mengandung alel heterozigot. SNP1_MGlu SNP2_MGlu SNP3_MGlu A. R A R A R A B. Gambar 40 Produk PCR hasil amplifikasi dari genom tanaman pisang cv. Klutuk Wulung (A) dan Barangan (B) menggunakan 6 pasang primer SNAP berdasarkan situs SNP pada gen MaGlu. R= primer reference, A= primer alternate

15 119 SNP1_MChi SNP2_MChi SNP3_MChi SNP4_MChi SNP5_MChi SNP6_MChi SNP7_MChi SNP8_MChi SNP9_MChi SNP10_MChi SNP11_MChi A. R A R A R A R A R A R A R A R A R A R A R A B. Gambar 41 Produk PCR hasil amplifikasi dari genom tanaman pisang cv. Klutuk Wulung (A) dan Barangan (B) menggunakan 22 pasang primer SNAP berdasarkan situs SNP pada gen MaChi. R= primer reference, A= primer alternate Hasil evaluasi 22 pasang primer SNAP berdasarkan fragmen gen chitinase menggunakan DNA genom pisang Klutuk Wulung dan Barangan ditampilkan pada Gambar 41. Berdasarkan elektroferogram (Gambar 41), pasangan primer yang diuji mampu menghasilkan produk PCR dan terdapat polimorfisme antar primer maupun antar kultivar pisang. Primer SNP4_MChi, SNP5_MChi, SNP7_MChi dan SNP11_MChi mampu menghasilkan produk PCR baik primer reference maupun alternate pada genom kedua kultivar pisang. Hal ini menunjukkan keempat lokus tersebut mempunyai kombinasi alel heterozigot pada kedua kultivar pisang. Lokus SNP1_MChi, SNP8_MChi dan SNP10_MChi mempunyai kombinasi alel heterozigot pada Klutuk Wulung, dan alel homozigot pada Barangan, sebaliknya primer SNP6_MChi dan SNP9_MChi mempunyai kombinasi alel heterozigot pada Barangan dan alel homozigot pada Klutuk Wulung. Lokus SNP2_MChi dan SNP3_MChi mengandung alel homozigot pada kedua kultivar pisang. Berdasarkan hasil pengujian tersebut dapat diketahui bahwa dari 11 lokus SNP yang diuji, Klutuk Wulung mempunyai 7 lokus heterozigot dan 4 lokus homozigot, sedangkan Barangan mempunyai 6 lokus heterozigot dan 5 lokus homozigot. Berdasarkan hasil pengujian tersebut dapat disarankan bahwa primer spesifik alel yang didisain bisa digunakan sebagai marka SNAP untuk keperluan analisis lebih lanjut. Sehubungan dengan pengembangan marka SNAP untuk marka ketahanan terhadap penyakit, marka molekuler berbasis SNP sebaiknya dikembangkan dari beberapa gen yang mempunyai peranan dalam ketahanan terhadap penyakit. Sebagai contoh implementasi marka SNAP berbasis SNP yang berasal dari gen MNBS dapat digabungkan dengan SNP yang berasal dari gen chitinase dan β- 1,3-glucanase tanaman pisang. Pemanfaatan SNP berbasis RGA dan DGA untuk Marka Ketahanan terhadap Penyakit Adanya keragaman SNP yang terkait (linkage) dengan fenotipe tertentu telah dilaporkan pada tanaman padi, kedelai dan bawang putih (Gupta et al. 2001). Mutasi akibat substitusi satu basa bisa merubah susunan asam amino dari polipeptida yang disandi oleh gen dan dapat merubah fungsi dari polipeptidanya (Kowarsch et al. 2010). Marka molekuler berbasis SNP dengan pendekatan PCR adalah lebih mudah dan efisien dalam pelaksanaannya bila dibandingkan dengan pendekatan enzim restriksi (Liu et al 2012). Salah satu marka molekular berbasis SNP yang menggunakan pendekatan teknik PCR adalah allel-specific PCR (AS-PCR) atau dikenal juga dengan nama SNAP (Drenkard et al. 2000).

16 120 Agar dapat dimanfaatkan sebagai marka ketahanan terhadap penyakit, marka SNAP berbasis RGA dan DGA perlu dievaluasi polimorfismenya dan keterkaitannya dengan sifat resistensi. Evaluasi tersebut perlu dilakukan untuk seluruh marka SNAP berbasis RGA dan DGA yang telah teridentifikasi. Apabila marka SNAP yang diuji mampu mengelompokkan kultivar atau spesies pisang yang berbeda-beda responnya terhadap penyakit, maka marka SNAP tersebut berpotensi digunakan sebagai marka untuk sifat resistensi penyakit. Evaluasi marka SNAP berbasis RGA pada 10 kultivar referensi. Hasil amplifikasi PCR menggunakan primer SNAP berbasis RGA pada 10 kultivar pisang ditampilkan pada Gambar 42. Dengan menggunakan primerprimer SNAP tersebut terlihat adanya polimorfisme pada produk amplifikasi PCR. Primer SNP1_MNBS (reference dan alternate) menghasilkan produk amplifikasi pada 10 kultivar yang diuji, hal ini berarti bahwa lokus SNP1_MNBS yang ada pada semua kultivar tersebut mengandung alel heterozigot, sedangkan primer SNAP yang lain menghasilkan produk amplifikasi yang beragam pada kesepuluh kultivar yang diuji (Gambar 42). Berdasarkan elektroferogram hasil amplifikasi PCR menggunakan primer SNAP berbasis RGA, diperoleh data genotipe seperti ditampilkan pada Tabel 26. Berdasarkan hasil analisis filogenetik terlihat bahwa semua primer SNAP berbasis RGA belum bisa mengelompokkan kultivar pisang berdasarkan sifat ketahanan terhadap penyakit layu FOC. Dalam dendogram tersebut, kultivar rentan berada dalam kelompok yang terpisah dan salah satu kultivar rentan Ambon Kuning menjadi satu kelompok dengan kultivar tahan FOC, Klutuk Wulung. Oleh karena itu untuk menjadikan primer SNAP sebagai marka ketahanan, tidak semua pasangan primer yang digunakan, tetapi dipilih salah satu atau beberapa pasang, serta dikombinasi dengan primer SNAP lain berbasis gen yang berperanan dalam ketahanan terhadap layu cendawan patogen SNP1_MNBS R A R A R A R A R A R A R A R A R A R A SNP2_MNBS SNP4_MNBS SNP5_MNBS SNP6_MNBS Gambar 42 Representasi analisis 5 primer SNAP berbasis RGA pada 10 kultivar pisang. R= primer reference, A= primer alternate, 1= Rejang, 2= Calcuta- 4, 3= Klutuk Wulung, 4= Kepok, 5= Jawaka, 6= Ketan, 7= Ambon Hijau, 8= Ambon Kuning, 9= Barangan, 10= Awak. R= primer reference, A= primer alternate

17 121 Tabel 26 Data genotipe hasil konversi dari elektroferogram produk PCR menggunakan primer SNAP berbasis RGA (MNBS) pada 10 kultivar pisang Kultivar SNP1_MNBS SNP2_MNBS SNP4_MNBS SNP5_MNBS SNP6_MNBS R A R A R A R A R A Rejang Calcuta Klutuk Wulung Kepok Jawaka Ketan Ambon Hijau Barangan Ambon Kuning Awak Keterangan: Jika (+)= ada produk, (-)= tidak ada produk, R(+)-A(-)= , R(-)-A(+)= , R(+)-A(+)= Pemilihan primer untuk marka SNAP dapat dilakukan dengan menganalisis setiap lokus. Analisis setiap lokus ini bertujuan untuk mendapatkan gambaran kemampuan setiap situs SNP dalam mengelompokan kultivar yang diuji berdasarkan sifat ketahanan terhadap penyakit layu FOC. Hasil analisis filogenetik setiap lokus untuk SNP berbasis RGA terhadap 10 kultivar pisang ditampilkan pada Lampiran 1. Berdasarkan hasil analisis terlihat bahwa primer SNP4_MNBS mampu mengelompokkan kultivar rentan (Ambon Kuning, Ambon Hijau dan Barangan) dalam satu kelompok, meskipun kultivar tahan Kepok dan Klutuk Wulung juga terikut dalam kelompok kultivar rentan. Kultivar tahan lainnya (Rejang, Calcuta-4, Jawaka dan Awak) sudah terkelompokkan menjadi satu. Dibandingkan dengan primer lainnya, primer SNP4_MNBS adalah primer yang lebih representatif, sehingga bisa digabungkan dengan primer SNAP berbasis gen chitinase dan β-1,3-glucanase sebagai marka ketahanan terhadap penyakit Coefficient Rejang (R) Jawaka (R) Awak (R) Klutuk_Wlg (R) Amb_Kng (S) Kepok (R) Ketan (R-S) Amb_Hj (S) Barangan (S) Calcuta-4 (R) Gambar 43 Dendogram hasil analisis filogenetik pengelompokkan kultivar berdasarkan hasil amplifikasi PCR menggunakan primer SNAP berbasis RGA (MNBS). Huruf dalam kurung di belakang kultivar menunjukkan karakter ketahanan masing-masing kultivar: R= tahan, S= rentan, R-S= rentan sampai tahan.

18 122 Evaluasi marka SNAP berbasis gen β-1,3-glucanase pada 10 kultivar referensi. Elektroferogram hasil amplifikasi primer SNAP berbasis gen β-1,3- glucanase ditampilkan pada Gambar 44. Berdasarkan hasil amplifikasi terlihat bahwa primer SNP1_MaGlu (reference dan alternate) menghasilkan polimorfisme pada produk amplifikasi PCR asal DNA genom 10 kultivar yang diuji, sedangkan dengan primer SNP2_MGlu dan SNP3_MGlu, baik pasangan primer reference maupun alternate semua menghasilkan produk amplifikasi pada 10 kultivar yang diuji (Gambar 44). Selanjutnya keberadaan pita amplifikasi dikonversi menjadi data binary ditampilkan pada Tabel 26 dan dendogram hasil analisis filogenetik ditampilkan pada Gambar 45. Berdasarkan dendogram pada Gambar 45, terlihat bahwa primer SNAP masih mengelompokkan kultivar rentan (Ambon Hijau, Ambon Kuning dan Barangan) menjadi satu dengan beberapa kultivar Rejang dan Calcuta-4. Oleh karena itu dalam aplikasinya primer SNAP berbasis gen β-1,3-glucanase tersebut perlu dikombinasi dengan primer SNAP berbasis RGA dan chitinase SNP1_MGlu R A R A R A R A R A R A R A R A R A R A SNP2_MGlu SNP3_MGlu Gambar44 Representasi analisis 5 primer SNAP berbasis gen β-1,3-glucanase pada 10 kultivar pisang. R= primer reference, A= primer alternate, 1= Rejang, 2= Calcuta-4, 3= Klutuk Wulung, 4= Kepok, 5= Jawaka, 6= Ketan, 7= Ambon Hijau, 8= Ambon Kuning, 9= Barangan, 10= Awak. Tabel 27 Data genotipe hasil konversi dari elektroferogram produk PCR menggunakan primer SNAP berbasis gen β-1,3-glucanase (MaGlu) pada 10 kultivar pisang Kultivar SNP1_MGlu SNP2_MGlu SNP3_MGlu R A R A R A Rejang Calcuta Klutuk Wulung Kepok Jawaka Ketan Ambon Hijau Barangan Ambon Kuning Awak Keterangan: Jika (+)= ada produk, (-)= tidak ada produk, R(+)-A(-)= , R(-)-A(+)= , R(+)-A(+)=

19 Coefficient Rejang (R) Calcuta-4 (R) Ketan (R-S) Amb_Hj (S) Barangan (S) Amb_Kng (S) Jawaka (R) Awak (R) Klutuk_Wlg (R) Kepok (R) Gambar 45 Dendogram hasil analisis filogenetik pengelompokkan kultivar berdasarkan hasil amplifikasi PCR menggunakan primer SNAP berbasis gen β-1,3-glucanase (MaGlu). Huruf dalam kurung di belakang kultivar menunjukkan karakter ketahanan masing-masing kultivar: R= tahan, S= rentan, R-S= rentan sampai tahan. Dalam proses analisis, data genotipe yang dianalisis hanya berdasarkan amplifikasi dari primer SNP1_MGlu saja, karena primer SNP lainnya menghasilkan produk yang monomorfik, sehingga kalaupun digunakan data tersebut, tidak akan mempengaruhi luaran, dalam hal ini hasil pengelompokkan dalam dendogram. Evaluasi marka SNAP berbasis gen chitinase pada 10 kultivar referensi. Amplifikasi PCR menggunakan primer SNAP berbasis gen chitinase yang diperoleh dari Percobaan 4 (Tabel 25) terhadap 10 kultivar pisang ditampilkan pada Gambar 46. Berdasarkan hasil amplifikasi PCR, terlihat adanya polimorfisme antar primer SNAP dan juga antar kultivar yang diuji. Primer SNP4_MChi, SNP5_MChi dan SNP7_MChi menghasilkan produk amplifikasi baik primer reference maupun alternate. Hal ini menunjukkan pada lokus tersebut, kesepuluh kultivar mengandung alel heterozigot, sedangkan primer SNAP yang lain menghasilkan produk amplifikasi yang beragam pada kesepuluh kultivar yang dievaluasi (Gambar 46) dan dikonversi menjadi data genotipe seperti ditampilkan dalam Tabel 28. Seperti halnya yang terjadi pada analisis filogenetik data genotipe berdasarkan gen β-1,3-glucanase, hasil skoring data monomorfik tidak digunakan untuk analisis data karena tidak mempengaruhi luaran yang tampak dalam dendogram. Hasil analisis filogenetik memperlihatkan semua primer SNAP berbasis gen chitinase belum bisa mengelompokkan kultivar pisang berdasarkan sifat ketahanan terhadap penyakit layu FOC. Kultivar-kultivar rentan seperti Ambon Hijau, Ambon Kuning dan Barangan berada dalam kelompok terpisah dan masing-masing bersama dengan kultivar tahan seperti Rejang dan Calcuta-4.

20 124 1 R 2 A R 3 A R 4 A R 5 A R 6 A R A R A R A R 10 A R A SNP1_MChi SNP2_MChi SNP3_MChi SNP4_MChi SNP5_MChi SNP6_MChi SNP7_MChi SNP8_MChi SNP9_MChi SNP10_MChi SNP11_MChi Gambar 46 Representasi analisis 5 primer SNAP berbasis gen chitinase pada 10 kultivar pisang. R= primer reference, A= primer alternate, 1= Rejang, 2= Calcuta-4, 3= Klutuk Wulung, 4= Kepok, 5= Jawaka, 6= Ketan, 7= Ambon Hijau, 8= Barangan, 9= Ambon Kuning, 10= Awak. Hal yang sama juga terjadi pada kultivar tahan FOC. Oleh karena itu untuk menjadikan primer SNAP sebagai marka ketahanan, tidak semua pasangan primer yang digunakan dan dipilih salah satu atau beberapa pasang, serta dikombinasi dengan primer SNAP lain berbasis gen yang berperanan dalam ketahanan terhadap patogen. Pemilihan primer untuk marka SNAP dapat dilakukan dengan menganalisis setiap lokus. Analisis setiap lokus ini bertujuan untuk mendapatkan gambaran kemampuan setiap situs SNP dalam mengelompokan kultivar yang diuji berdasarkan sifat ketahanan terhadap penyakit layu FOC. Keragaan hasil analisis setiap lokus ditampilkan pada Lampiran 2. Dari hasil analisis tiap lokus terpilih kombinasi lokus SNP2_MChi, SNP6_MChi, SNP8_MChi, SNP10_MChi dan SNP11_MChi yang digunakan sebagai marka SNAP. Hasil analisis filogenetik yang menggabungkan kelima lokus tersebut ditampilkan pada Gambar 48. Namun demikian pengelompokkan kultivar yang diperoleh masih belum sempurna mewakili pengelompokkan berdasarkan karakter ketahanan masing-masing kultivar terhadap FOC. Oleh karena itu dalam aplikasinya primer SNAP berbasis gen chitinase ini perlu dikombinasi dengan primer SNAP berbasis RGA dan β-1,3glucanase

21 125 Tabl 28 Data genotipe hasil konversi dari elektroferogram produk PCR menggunakan primer SNAP berbasis gen chitinase (MaChi) pada 10 kultivar pisang SNP1_MChi SNP2_MChi SNP3_MChi SNP4_MChi SNP5_MChi SNP6_MChi Kultivar R A R A R A R A R A R A Rejang Calcuta Klutuk Wlg Kepok Jawaka Ketan Ambon Hj Barangan Ambon Kng Awak Kultivar SNP7_MChi SNP8_MChi SNP9_MChi SNP10_MChi SNP11_MChi R A R A R A R A R A Rejang Calcuta Klutuk Wlg Kepok Jawaka Ketan Ambon Hj Barangan Ambon Kng Awak Keterangan: Jika (+)= ada produk, (-)= tidak ada produk, R(+)-A(-)= , R(-)-A(+)= , R(+)-A(+)= Coefficient Rejang (R) Amb_Hj (S) Kepok (R) Awak (R) Jawaka (R) Calcuta-4 (R) Amb_Kng (S) Ketan (R-S) Barangan (S) Klutuk_Wlg (R) Gambar 47 Dendogram hasil analisis filogenetik pengelompokkan kultivar berdasarkan hasil amplifikasi PCR menggunakan primer SNAP untuk 10 lokus berbasis gen chitinase (MaChi). Huruf dalam kurung di belakang kultivar menunjukkan karakter ketahanan masing-masing kultivar: R= tahan, S= rentan, R-S= rentan sampai tahan.

22 126 Rejang (R) Ketan (R-S) Amb_Hj (S) Amb_Kng (S) Calcuta-4 (R) Barangan (S) Klutuk_Wlg (R) Kepok (R) Jawaka (R) Awak (R) Coefficient Gambar 48 Dendogram hasil analisis filogenetik pengelompokkan kultivar berdasarkan hasil amplifikasi PCR menggunakan primer SNP2_MChi, SNP6_MChi, SNP8_MChi, SNP10_MChi dan SNP11_MChi. R= tahan, S= rentan, R-S= rentan sampai tahan. (A) (B) Gambar 49 Dendogram hasil analisis filogenetik pengelompokkan kultivar berdasarkan hasil amplifikasi PCR menggunakan primer SNP4_MNBS, SNP2_MChi, SNP6_MChi, SNP8_MChi, SNP10_MChi, SNP11_MChi yang melibatkan primer SNP1_MGlu (A) dan yang tidak (B). R= tahan, S= rentan, R-S= rentan sampai tahan.

23 127 Dengan menggabungkan primer-primer SNAP terpilih dari ketiga kelompok gen yang diperoleh dari penelitian ini, yaitu RGA (MNBS), β-1,3- glucanase dan chitinase, diperoleh pengelompokkan kultivar berdasarkan karakter ketahanan terhadap FOC yang lebih baik, seperti terlihat pada Gambar 49A dan 49B. Gambar 49A adalah melibatkan primer SNP1_MGlu sedangkan Gambar 49B tanpa melibatkan primer SNP1_MGlu. Dendogram yang dihasilkan baik tanpa atau dengan melibatkan primer SNP1_MGlu dapat mengelompokkan kultivar berdasarkan ketahanan terhadap FOC. Namun demikian dengan tanpa melibatkan primer SNP1_MGlu pengelompokkan yang diperoleh menjadi lebih baik (Gambar 49B) karena dapat memisahkan cabang kelompok kultivar rentan dengan kultivar tahan (pada koefisien kemiripan 83 %). Oleh karena itu untuk pengujian marka menggunakan kultivar/aksesi lain, tanpa melibatkan primer SNP1_MGlu. Evaluasi marka SNAP pada 10 kultivar/aksesi yang belum diketahui karakter ketahanan terhadap FOC. Dendogram hasil evaluasi yang dilakukan menggunakan DNA genom 10 kultivar/aksesi yang belum diketahui karakter ketahanan terhadap FOC bersama dengan 10 kultivar referensi, ditampilkan pada Gambar 50. Berdasarkan koefisien kemiripan sebesar 80 %, kultivar/aksesi tersebut dibagi menjadi 3 kelompok besar, yaitu R-I (kultivar resisten I) yang terdiri atas 3 kultivar, 2 kultivar adalah Rejang dan Calcuta-4 yang tahan FOC dan satu aksesi AMB-01 (Tongka Langit dari Maluku). Kelompok kedua adalah R-II (kultivar resisten II) yang terdiri atas 10 kultivar/aksesi. Yang termasuk dalam kelompok ini adalah Klutuk Wulung, Kepok, Jawaka dan Awak yang diketahui tahan FOC, dan beberapa kultivar seperti Muli, MDO-01, MBO-04, MLU-07, SUM-04 serta satu spesies liar HlbS-01. Kelompok ketiga adalah S (rentan) yang beranggotakan beberapa kultivar rentan seperti Ambon Hijau, Ambon Kuning, Barangan dan yang rentan sampai tahan yaitu Ketan. Kultivar Ketan sebetulnya termasuk kultivar yang toleran atau mempunyai ketahanan terhadap FOC sedang. Namun demikian hal ini juga mengkonfirmasi hasil Percobaan 1 (BAB II) bahwa meskipun Ketan dikategorikan kultivar tahan (Tabel 2), tetapi sebanyak 42.% tanaman menunjukkan gejala RDI dan LSI sedang (LSI= 2-3 dan RDI= 2-3), jadi sebetulnya Ketan adalah kultivar yang mempunyai tingkat ketahanan rentan sampai tahan terhadap FOC. Dalam kelompok ketiga ini juga terdapat satu spesies liar Slk-29 dan 2 kultivar (SUM-01 dan HyKC). Walaupun berdasarkan hasil analisis filogenetik marka SNAP terpilih bisa mengelompokkan kultivar berdasarkan ketahanan terhadap FOC, tetapi markamarka tersebut perlu diuji pada populasi bersegregasi. Selain itu untuk validasi marka, diperlukan pengujian lebih lanjut terhadap aksesi-aksesi lain yang juga diuji ketahanannya terhadap cendawan FOC. Namun demikian metode ini merupakan tahapan awal pada pemilihan marka SNAP berdasar situs SNP yang terdapat dalam gen yang bertanggung jawab pada ketahanan dan pertahanan tanaman terhadap patogen. Selain itu, dari penelitian ini dapat diketahui bahwa terdapat perbedaan susunan basa nukleotida antara kultivar pisang yang rentan dan tahan terhadap penyakit layu FOC, dan perbedaan nukleotida tersebut bisa merubah residu asam amino.

BAB VIII PEMBAHASAN UMUM

BAB VIII PEMBAHASAN UMUM BAB VIII PEMBAHASAN UMUM Pengembangan tanaman pisang di Indonesia masih terus berlangsung walaupun menghadapi beberapa kendala baik kendala teknis maupun non teknis. Kendala non teknis berupa makin berkurangnya

Lebih terperinci

J. Hort. Vol. 23 No. 4, 2013 J. Hort. 23(4): , Sutanto, A 1), Hermanto, C 1), Sukma, D 2), dan Sudarsono 2) 1)

J. Hort. Vol. 23 No. 4, 2013 J. Hort. 23(4): , Sutanto, A 1), Hermanto, C 1), Sukma, D 2), dan Sudarsono 2) 1) J. Hort. Vol. 23 No. 4, 2013 J. Hort. 23(4):300-309, 2013 Pengembangan Marka SNAP Berbasis Resistance Gene Analogue Pada Tanaman Pisang (Musa spp.) (Development of SNAP Marker Based On Resistance Gene

Lebih terperinci

MATERI DAN METODE. Lokasi dan Waktu. Materi. Tabel 1. Jumah Sampel Darah Ternak Sapi Indonesia Ternak n Asal Sapi Bali 2 4

MATERI DAN METODE. Lokasi dan Waktu. Materi. Tabel 1. Jumah Sampel Darah Ternak Sapi Indonesia Ternak n Asal Sapi Bali 2 4 MATERI DAN METODE Lokasi dan Waktu Penelitian dilaksanakan di Laboratorium Genetika Molekuler Ternak, Bagian Pemuliaan dan Genetika Ternak, Fakultas Peternakan, Institut Pertanian Bogor. penelitian ini

Lebih terperinci

HASIL DAN PEMBAHASAN. divisualisasikan padaa gel agarose seperti terlihat pada Gambar 4.1. Ukuran pita

HASIL DAN PEMBAHASAN. divisualisasikan padaa gel agarose seperti terlihat pada Gambar 4.1. Ukuran pita IV. HASIL DAN PEMBAHASAN 4.1. Amplifikasi Gen Mx Amplifikasi gen Mx telah berhasil dilakukan. Hasil amplifikasi gen Mx divisualisasikan padaa gel agarose seperti terlihat pada Gambar 4.1. Ukuran pita yang

Lebih terperinci

MATERI DAN METODE. Lokasi dan Waktu. Materi

MATERI DAN METODE. Lokasi dan Waktu. Materi MATERI DAN METODE Lokasi dan Waktu Penelitian ini dilaksanakan di Laboratorium Genetika Molekuler, Bagian Pemuliaan dan Genetika Ternak, Departemen Ilmu Produksi dan Teknologi Peternakan, Fakultas Peternakan,

Lebih terperinci

HASIL DAN PEMBAHASAN

HASIL DAN PEMBAHASAN HASIL DAN PEMBAHASAN Amplifikasi Gen GH Exon 4 Amplifikasi gen GH exon 4 pada kambing Peranakan Etawah (PE), Saanen dan PESA (Persilangan PE-Saanen) diperoleh panjang fragmen 200 bp (Gambar 8). M 1 2 3

Lebih terperinci

PENANDA KODOMINAN B11 BERDASARKAN CAPS SEBAGAI ALAT SELEKSI TOLERANSI TANAMAN PADI TERHADAP CEKAMAN ALUMINIUM

PENANDA KODOMINAN B11 BERDASARKAN CAPS SEBAGAI ALAT SELEKSI TOLERANSI TANAMAN PADI TERHADAP CEKAMAN ALUMINIUM PENANDA KODOMINAN B11 BERDASARKAN CAPS SEBAGAI ALAT SELEKSI TOLERANSI TANAMAN PADI TERHADAP CEKAMAN ALUMINIUM (CAPS Based Codominant Marker Of B11 as Selective Tool for Rice Aluminum Tolerance Trait) Abstrak

Lebih terperinci

HASIL DAN PEMBAHASAN. Amplifikasi Gen Pituitary-Specific Positive Transcription Factor 1 (Pit1) Exon 3

HASIL DAN PEMBAHASAN. Amplifikasi Gen Pituitary-Specific Positive Transcription Factor 1 (Pit1) Exon 3 HASIL DAN PEMBAHASAN Amplifikasi Gen Pituitary-Specific Positive Transcription Factor 1 (Pit1) Exon 3 Amplifikasi gen Pit1 exon 3 pada sapi FH yang berasal dari BIB Lembang, BBIB Singosari, BPPT Cikole,

Lebih terperinci

KARAKTERISASI MOLEKULER KETAHANAN BEBERAPA KULTIVAR PISANG (Musa spp.) TERHADAP PENYAKIT LAYU PANAMA (Fusarium oxysporum f.sp. cubense) AGUS SUTANTO

KARAKTERISASI MOLEKULER KETAHANAN BEBERAPA KULTIVAR PISANG (Musa spp.) TERHADAP PENYAKIT LAYU PANAMA (Fusarium oxysporum f.sp. cubense) AGUS SUTANTO KARAKTERISASI MOLEKULER KETAHANAN BEBERAPA KULTIVAR PISANG (Musa spp.) TERHADAP PENYAKIT LAYU PANAMA (Fusarium oxysporum f.sp. cubense) AGUS SUTANTO SEKOLAH PASCASARJANA INSTITUT PERTANIAN BOGOR BOGOR

Lebih terperinci

BAB I PENDAHULUAN. (plasma nutfah) tumbuhan yang sangat besar. Kekayaan tersebut menempatkan

BAB I PENDAHULUAN. (plasma nutfah) tumbuhan yang sangat besar. Kekayaan tersebut menempatkan BAB I PENDAHULUAN 1.1 Latar Belakang Indonesia merupakan negara tropis dengan kekayaan sumber daya genetik (plasma nutfah) tumbuhan yang sangat besar. Kekayaan tersebut menempatkan Indonesia negara dengan

Lebih terperinci

HASIL DAN PEMBAHASAN

HASIL DAN PEMBAHASAN HASIL DAN PEMBAHASAN Amplifikasi ini membutuhkan primer spesifik (sekuen oligonukelotida khusus) untuk daerah tersebut. Primer biasanya terdiri dari 10-20 nukleotida dan dirancang berdasarkan daerah konservatif

Lebih terperinci

BAB 4 HASIL PERCOBAAN DAN PEMBAHASAN

BAB 4 HASIL PERCOBAAN DAN PEMBAHASAN BAB 4 HASIL PERCOBAAN DAN PEMBAHASAN Sebelum melakukan PCR, terlebih dahulu dilakukan perancangan primer menggunakan program DNA Star. Pemilihan primer dilakukan dengan mempertimbangkan parameter spesifisitas,

Lebih terperinci

HASIL DAN PEMBAHASAN. Gambar 4. Hasil Amplifikasi Gen FSHR Alu-1pada gel agarose 1,5%.

HASIL DAN PEMBAHASAN. Gambar 4. Hasil Amplifikasi Gen FSHR Alu-1pada gel agarose 1,5%. HASIL DAN PEMBAHASAN Amplifikasi Gen FSHR Alu-1 Amplifikasi fragmen gen FSHR Alu-1 dengan metode Polymerase Chain Reaction (PCR) dilakukan dengan kondisi annealing 60 C selama 45 detik dan diperoleh produk

Lebih terperinci

DASAR BIOTEKNOLOGI TANAMAN

DASAR BIOTEKNOLOGI TANAMAN DASAR BIOTEKNOLOGI TANAMAN Darda Efendi, Ph.D Nurul Khumaida, Ph.D Sintho W. Ardie, Ph.D Departemen Agronomi dan Hortikultura, Faperta, IPB 2013 Marka = tanda Marka (marka biologi) adalah sesuatu/penanda

Lebih terperinci

PRAKATA. Alhamdulillah syukur senantiasa penulis panjatkan kepada Allah swt., atas

PRAKATA. Alhamdulillah syukur senantiasa penulis panjatkan kepada Allah swt., atas PRAKATA Alhamdulillah syukur senantiasa penulis panjatkan kepada Allah swt., atas segala nikmat dan karunia-nya, penulisan Tugas Akhir dengan judul Keragaman Genetik Abalon (Haliotis asinina) Selat Lombok

Lebih terperinci

Kolokium Departemen Biologi FMIPA IPB: Ria Maria

Kolokium Departemen Biologi FMIPA IPB: Ria Maria Kolokium Departemen Biologi FMIPA IPB: Ria Maria Ria Maria (G34090088), Achmad Farajallah, Maria Ulfah. 2012. Karakterisasi Single Nucleotide Polymorphism Gen CAST pada Ras Ayam Lokal. Makalah Kolokium

Lebih terperinci

BAB I PENDAHULUAN. 1.1 Latar Belakang

BAB I PENDAHULUAN. 1.1 Latar Belakang BAB I PENDAHULUAN 1.1 Latar Belakang Varietas unggul padi telah tersebar di seluruh dunia untuk dijadikan bibit yang digunakan oleh para petani. Pemerintah Republik Indonesia telah mengeluarkan lebih dari

Lebih terperinci

MATERI DAN METODE. Kota Padang Sumatera Barat pada bulan Oktober Amplifikasi gen Growth

MATERI DAN METODE. Kota Padang Sumatera Barat pada bulan Oktober Amplifikasi gen Growth III. MATERI DAN METODE 3.1 Waktu dan Tempat Pengambilan sampel darah domba dilakukan di Kecamatan Koto Tengah Kota Padang Sumatera Barat pada bulan Oktober 2012. Amplifikasi gen Growth Hormone menggunakan

Lebih terperinci

DAFTAR ISI DAFTAR SINGKATAN DAN LAMBANG

DAFTAR ISI DAFTAR SINGKATAN DAN LAMBANG DAFTAR ISI ABSTRAK... Error! ABSTRACT... Error! KATA PENGANTAR... Error! DAFTAR ISI... i DAFTAR SINGKATAN DAN LAMBANG... Error! BAB I PENDAHULUAN... Error! 1.1 Latar Belakang... Error! 1.2 Rumusan Masalah...

Lebih terperinci

HASIL DAN PEMBAHASAN

HASIL DAN PEMBAHASAN HASIL DAN PEMBAHASAN Amplifikasi Gen Calpastatin (CAST MspI) Amplifikasi fragmen gen calpastatin (CAST MspI) pada setiap bangsa sapi dilakukan dengan menggunakan mesin thermal cycler (AB Bio System) pada

Lebih terperinci

HASIL DAN PEMBAHASAN

HASIL DAN PEMBAHASAN HASIL DAN PEMBAHASAN Amplifikasi Gen GH Gen GH exon 3 pada kambing PE, Saanen, dan PESA (Persilangan PE dan Saanen) berhasil diamplifikasi menggunakan metode PCR (Polymerase Chain Reaction). Panjang fragmen

Lebih terperinci

Gambar 5. Hasil Amplifikasi Gen Calpastatin pada Gel Agarose 1,5%.

Gambar 5. Hasil Amplifikasi Gen Calpastatin pada Gel Agarose 1,5%. HASIL DAN PEMBAHASAN Amplifikasi Gen Calpastatin (CAST AluI) Amplifikasi fragmen gen CAST AluI dilakukan dengan menggunakan mesin PCR dengan kondisi annealing 60 0 C selama 45 detik, dan diperoleh produk

Lebih terperinci

I. PENDAHULUAN. Jenis kelamin menjadi salah satu studi genetik yang menarik pada tanaman

I. PENDAHULUAN. Jenis kelamin menjadi salah satu studi genetik yang menarik pada tanaman I. PENDAHULUAN 1.1 Latar Belakang Jenis kelamin menjadi salah satu studi genetik yang menarik pada tanaman dioecious. Jenis kelamin betina menjamin keberlangsungan hidup suatu individu, dan juga penting

Lebih terperinci

ANALISIS KERAGAMAN GENETIK MUTAN JARAK PAGAR (Jatropha curcas L.) HASIL PERLAKUAN MUTAGEN KOLKISIN BERDASARKAN PENANDA MOLEKULER RAPD

ANALISIS KERAGAMAN GENETIK MUTAN JARAK PAGAR (Jatropha curcas L.) HASIL PERLAKUAN MUTAGEN KOLKISIN BERDASARKAN PENANDA MOLEKULER RAPD ANALISIS KERAGAMAN GENETIK MUTAN JARAK PAGAR (Jatropha curcas L.) HASIL PERLAKUAN MUTAGEN KOLKISIN BERDASARKAN PENANDA MOLEKULER RAPD Herdiyana Fitriani Dosen Program Studi Pendidikan Biologi FPMIPA IKIP

Lebih terperinci

BAB III METODE PENELITIAN Bagan Alir Penelitian ini secara umum dapat digambarkan pada skema berikut:

BAB III METODE PENELITIAN Bagan Alir Penelitian ini secara umum dapat digambarkan pada skema berikut: BAB III METODE PENELITIAN Tahapan-tahapan yang dilakukan dalam penelitian ini adalah: pengumpulan sampel, lisis terhadap sampel mtdna yang telah diperoleh, amplifikasi daerah HVI mtdna sampel dengan menggunakan

Lebih terperinci

HASIL DAN PEMBAHASAN. Amplifikasi Gen GH Exon 2

HASIL DAN PEMBAHASAN. Amplifikasi Gen GH Exon 2 HASIL DAN PEMBAHASAN Amplifikasi Gen GH Exon 2 Gen GH exon 2 pada ternak kambing PE, Saanen, dan persilangannya (PESA) berhasil diamplifikasi menggunakan teknik PCR (Polymerase Chain Reaction). Pasangan

Lebih terperinci

HASIL DAN PEMBAHASAN

HASIL DAN PEMBAHASAN HASIL DAN PEMBAHASAN Virus Hepatitis B Gibbon Regio Pre-S1 Amplifikasi Virus Hepatitis B Regio Pre-S1 Hasil amplifikasi dari 9 sampel DNA owa jawa yang telah berstatus serologis positif terhadap antigen

Lebih terperinci

BAB III METODOLOGI PENELITIAN. Penelitian akan diawali dengan preparasi alat dan bahan untuk sampling

BAB III METODOLOGI PENELITIAN. Penelitian akan diawali dengan preparasi alat dan bahan untuk sampling 16 BAB III METODOLOGI PENELITIAN Penelitian akan diawali dengan preparasi alat dan bahan untuk sampling sel folikel akar rambut. Sampel kemudian dilisis, diamplifikasi dan disekuensing dengan metode dideoksi

Lebih terperinci

ANALISA HASIL TRANSFORMASI DENGAN MENGGUNAKAN PCR KOLONI DAN RESTRIKSI

ANALISA HASIL TRANSFORMASI DENGAN MENGGUNAKAN PCR KOLONI DAN RESTRIKSI 1 ANALISA HASIL TRANSFORMASI DENGAN MENGGUNAKAN PCR KOLONI DAN RESTRIKSI PENDAHULUAN Polimerase Chain Reaction (PCR) PCR adalah suatu reaksi invitro untuk menggandakan jumlah molekul DNA pada target tertentu

Lebih terperinci

Elektroforesis Hasil Amplifikasi Analisis Segregasi Marka SSR Amplifikasi DNA Kelapa Sawit dengan Primer Mikrosatelit HASIL DAN PEMBAHASAN

Elektroforesis Hasil Amplifikasi Analisis Segregasi Marka SSR Amplifikasi DNA Kelapa Sawit dengan Primer Mikrosatelit HASIL DAN PEMBAHASAN 11 annealing yang tepat dengan mengatur reaksi pada berbagai suhu dalam satu reaksi sekaligus sehingga lebih efektif dan efisien. Proses optimasi dilakukan menggunakan satu sampel DNA kelapa sawit yaitu

Lebih terperinci

HASIL DAN PEMBAHASAN. (a)

HASIL DAN PEMBAHASAN. (a) 8 tampak diskor secara manual. Kriteria penskoran berdasarkan muncul tidaknya lokus, lokus yang muncul diberi skor 1 dan yang tidak muncul diberi skor 0. Data biner yang diperoleh selanjutnya diolah menjadi

Lebih terperinci

TINJAUAN PUSTAKA Sapi Lokal Kalimantan Tengah

TINJAUAN PUSTAKA Sapi Lokal Kalimantan Tengah TINJAUAN PUSTAKA Sapi Lokal Kalimantan Tengah Berdasarkan aspek pewilayahan Kalimantan Tengah mempunyai potensi besar untuk pengembangan peternakan dilihat dari luas lahan 153.564 km 2 yang terdiri atas

Lebih terperinci

BAB 4 HASIL PERCOBAAN DAN BAHASAN. Oligonukleotida sintetis daerah pengkode IFNα2b sintetis dirancang menggunakan

BAB 4 HASIL PERCOBAAN DAN BAHASAN. Oligonukleotida sintetis daerah pengkode IFNα2b sintetis dirancang menggunakan BAB 4 HASIL PERCOBAAN DAN BAHASAN Oligonukleotida sintetis daerah pengkode IFNα2b sintetis dirancang menggunakan program komputer berdasarkan metode sintesis dua arah TBIO, dimana proses sintesis daerah

Lebih terperinci

BIO306. Prinsip Bioteknologi

BIO306. Prinsip Bioteknologi BIO306 Prinsip Bioteknologi KULIAH 7. PUSTAKA GENOM DAN ANALISIS JENIS DNA Konstruksi Pustaka DNA Pustaka gen merupakan sumber utama isolasi gen spesifik atau fragmen gen. Koleksi klon rekombinan dari

Lebih terperinci

Teknik-teknik Dasar Bioteknologi

Teknik-teknik Dasar Bioteknologi Teknik-teknik Dasar Bioteknologi Oleh: TIM PENGAMPU Program Studi Agroteknologi Fakultas Pertanian Universitas Jember Tujuan Perkuliahan 1. Mahasiswa mengetahui macam-macam teknik dasar yang digunakan

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN A. Jenis penelitian Jenis penelitian ini adalah penelitian deskriptif yang mengangkat fenomena alam sebagai salah satu masalah dalam penelitian, sehingga dapat menerangkan arti

Lebih terperinci

BAB III BAHAN DAN METODE

BAB III BAHAN DAN METODE 9 BAB III BAHAN DAN METODE 3.1 Waktu dan Tempat Penelitian Penelitian dilaksanakan pada bulan September 2011 sampai dengan Juli 2012. Kegiatan ekstraksi DNA sampai PCR-RFLP dilakukan di laboratorium Analisis

Lebih terperinci

BAB III METODE PENELITIAN. amplifikasi daerah HVI mtdna sampel dengan menggunakan teknik PCR;

BAB III METODE PENELITIAN. amplifikasi daerah HVI mtdna sampel dengan menggunakan teknik PCR; BAB III METODE PENELITIAN Secara garis besar, langkah-langkah yang dilakukan dalam penelitian ini adalah: pengumpulan sampel; lisis terhadap sampel mtdna yang telah diperoleh; amplifikasi daerah HVI mtdna

Lebih terperinci

III. BAHAN DAN METODE

III. BAHAN DAN METODE III. BAHAN DAN METODE Tempat dan Waktu Penelitian dilakukan di Laboratorium BIORIN (Biotechnology Research Indonesian - The Netherlands) Pusat Penelitian Sumberdaya Hayati dan Bioteknologi IPB. Penelitian

Lebih terperinci

BAB I PENDAHULUAN. eks-karesidenan Surakarta (Sragen, Boyolali, Karanganyar, Sukoharjo) (Prihatman,

BAB I PENDAHULUAN. eks-karesidenan Surakarta (Sragen, Boyolali, Karanganyar, Sukoharjo) (Prihatman, 1 BAB I PENDAHULUAN A. Latar Belakang Tanaman Melon (Cucumis melo L.) merupakan tanaman dari famili Cucurbitaceae yang banyak dikonsumsi bagian daging buahnya. Konsumsi buah melon cukup tinggi karena kandungan

Lebih terperinci

BAB XII. REAKSI POLIMERISASI BERANTAI

BAB XII. REAKSI POLIMERISASI BERANTAI BAB XII. REAKSI POLIMERISASI BERANTAI Di dalam Bab XII ini akan dibahas pengertian dan kegunaan teknik Reaksi Polimerisasi Berantai atau Polymerase Chain Reaction (PCR) serta komponen-komponen dan tahapan

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN A. Jenis Penelitian Jenis penelitian ini adalah penelitian deskriptif yang mengangkat fenomena alam sebagai salah satu masalah dalam penelitian. Penelitian ini dapat menerangkan

Lebih terperinci

MATERI DAN METODE Waktu dan Tempat Materi Sapi Perah FH

MATERI DAN METODE Waktu dan Tempat Materi Sapi Perah FH 62 MATERI DAN METODE Waktu dan Tempat Penelitian ini dilaksanakan selama sembilan bulan, yaitu dari bulan Oktober 2009 sampai dengan Juni 2010. Penelitian ini dilaksanakan di Laboratorium Genetika Molekuler,

Lebih terperinci

BAB III METODE PENELITIAN. Penelitian ini merupakan penelitian eksperimental dengan 7 sampel dari 7

BAB III METODE PENELITIAN. Penelitian ini merupakan penelitian eksperimental dengan 7 sampel dari 7 BAB III METODE PENELITIAN 3.1 Rancangan Penelitian Penelitian ini merupakan penelitian eksperimental dengan 7 sampel dari 7 individu udang Jari yang diambil dari Segara Anakan Kabupaten Cilacap Jawa Tengah.

Lebih terperinci

BAB IV HASIL DAN PEMBAHASAN. Sintesis fragmen gen HA Avian Influenza Virus (AIV) galur

BAB IV HASIL DAN PEMBAHASAN. Sintesis fragmen gen HA Avian Influenza Virus (AIV) galur 20 BAB IV HASIL DAN PEMBAHASAN A. KONDISI OPTIMAL REAKSI AMPLIFIKASI Sintesis fragmen 688--1119 gen HA Avian Influenza Virus (AIV) galur A/Indonesia/5/2005 dilakukan dengan teknik overlapping extension

Lebih terperinci

BAB III METODE PENELITIAN. Dalam penelitian ini dilakukan lima tahap utama yang meliputi tahap

BAB III METODE PENELITIAN. Dalam penelitian ini dilakukan lima tahap utama yang meliputi tahap BAB III METODE PENELITIAN Dalam penelitian ini dilakukan lima tahap utama yang meliputi tahap penyiapan templat mtdna, amplifikasi fragmen mtdna pada daerah D-loop mtdna manusia dengan teknik PCR, deteksi

Lebih terperinci

ANALISIS KERAGAMAN DNA TANAMAN DURIAN SUKUN (Durio zibethinus Murr.) BERDASARKAN PENANDA RAPD

ANALISIS KERAGAMAN DNA TANAMAN DURIAN SUKUN (Durio zibethinus Murr.) BERDASARKAN PENANDA RAPD ANALISIS KERAGAMAN DNA TANAMAN DURIAN SUKUN (Durio zibethinus Murr.) BERDASARKAN PENANDA RAPD Endang Yuniastuti, Supriyadi, Ismi Puji Ruwaida Jurusan Agronomi Fakultas Pertanian UNS Email: is_me_cute@yahoo.co.id

Lebih terperinci

HASIL DAN PEMBAHASAN. DNA Genom

HASIL DAN PEMBAHASAN. DNA Genom IV. HASIL DAN PEMBAHASAN A. Isolasi DNA Metode isolasi dilakukan untuk memisahkan DNA dari komponen sel yang lain (Ilhak dan Arslan, 2007). Metode isolasi ini sesuai dengan protokol yang diberikan oleh

Lebih terperinci

3. METODE PENELITIAN

3. METODE PENELITIAN 29 3. METODE PENELITIAN 3.1. Lokasi dan Waktu Penelitian Lokasi penelitian meliputi Laut Sulawesi, Selat Makassar, Teluk Bone, Laut Flores, Laut Banda, Teluk Tolo, Laut Maluku dan Teluk Tomini (Gambar

Lebih terperinci

PENDAHULUAN. Latar Belakang

PENDAHULUAN. Latar Belakang PENDAHULUAN Latar Belakang Usaha peternakan di Provinsi Nanggroe Aceh Darussalam secara umum telah dilakukan secara turun temurun meskipun dalam jumlah kecil skala rumah tangga, namun usaha tersebut telah

Lebih terperinci

METODE PENELITIAN. Tabel 1 Sampel yang digunakan dalam penelitian

METODE PENELITIAN. Tabel 1 Sampel yang digunakan dalam penelitian 12 METODE PEELITIA Waktu dan Tempat Penelitian dilaksanakan pada bulan Mei sampai dengan April 2010, bertempat di Bagian Fungsi Hayati dan Perilaku Hewan, Departemen Biologi, Fakultas Matematika dan Ilmu

Lebih terperinci

4 Hasil dan Pembahasan

4 Hasil dan Pembahasan 4 Hasil dan Pembahasan Dalam bab ini akan dipaparkan hasil dari tahap-tahap penelitian yang telah dilakukan. Melalui tahapan tersebut diperoleh urutan nukleotida sampel yang positif diabetes dan sampel

Lebih terperinci

MATERI DAN METODE. Materi. Tabel 1. Sampel Darah Sapi Perah dan Sapi Pedaging yang Digunakan No. Bangsa Sapi Jenis Kelamin

MATERI DAN METODE. Materi. Tabel 1. Sampel Darah Sapi Perah dan Sapi Pedaging yang Digunakan No. Bangsa Sapi Jenis Kelamin MATERI DAN METODE Lokasi dan Waktu Penelitian ini dilaksanakan di Laboratorium Genetika Molekuler Ternak, Bagian Pemuliaan dan Genetika, Fakultas Peternakan, Institut Pertanian Bogor. Penelitian ini berlangsung

Lebih terperinci

BAB III METODE PENELITIAN. Secara garis besar langkah-langkah yang dilakukan dalam penelitian ini

BAB III METODE PENELITIAN. Secara garis besar langkah-langkah yang dilakukan dalam penelitian ini BAB III METODE PENELITIAN Secara garis besar langkah-langkah yang dilakukan dalam penelitian ini adalah: pengumpulan sampel; lisis terhadap sampel mtdna yang telah diperoleh; amplifikasi daerah D-loop

Lebih terperinci

1 0,53 0,59 2 0,3 0,2 3 0,02 0,02 4 0,04 0,04 5 0,3 0,3 Ilustrasi rangkaian isolasi DNA tersebut dapat dilihat pada Gambar 1 berikut.

1 0,53 0,59 2 0,3 0,2 3 0,02 0,02 4 0,04 0,04 5 0,3 0,3 Ilustrasi rangkaian isolasi DNA tersebut dapat dilihat pada Gambar 1 berikut. PERBANDINGAN BEBERAPA METODE ISOLASI DNA UNTUK PENENTUAN KUALITAS LARUTAN DNA TANAMAN SINGKONG (Manihot esculentum L.) Molekul DNA dalam suatu sel dapat diekstraksi atau diisolasi untuk berbagai macam

Lebih terperinci

PENANDA KODOMINAN B11 BERDASARKAN CAPS SEBAGAI ALAT SELEKSI TOLERANSI TANAMAN PADI TERHADAP CEKAMAN ALUMINIUM *)

PENANDA KODOMINAN B11 BERDASARKAN CAPS SEBAGAI ALAT SELEKSI TOLERANSI TANAMAN PADI TERHADAP CEKAMAN ALUMINIUM *) PENANDA KODOMINAN B11 BERDASARKAN CAPS SEBAGAI ALAT SELEKSI TOLERANSI TANAMAN PADI TERHADAP CEKAMAN ALUMINIUM *) (CAPS Based Codominant Marker Of B11 as Selective Tool for Rice Aluminum Tolerance Trait)

Lebih terperinci

TINJAUAN PUSTAKA Sapi Perah Friesian Holstein

TINJAUAN PUSTAKA Sapi Perah Friesian Holstein TINJAUAN PUSTAKA Sapi Perah Friesian Holstein Sapi Friesian Holstein (FH) merupakan bangsa sapi yang paling banyak terdapat di Amerika Serikat, sekitar 80-90% dari seluruh sapi perah yang berada di sana.

Lebih terperinci

BAB III METODE PENELITIAN. Penelitian ini merupakan penelitian yang dilakukan dengan metode

BAB III METODE PENELITIAN. Penelitian ini merupakan penelitian yang dilakukan dengan metode 16 BAB III METODE PENELITIAN A. Jenis Penelitian Penelitian ini merupakan penelitian yang dilakukan dengan metode deskriptif. Penelitian deskriptif adalah suatu metode penelitian untuk membuat deskripsi,

Lebih terperinci

HASIL DAN PEMBAHASAN. Amplifikasi Daerah D-loop M B1 B2 B3 M1 M2 P1 P2 (-)

HASIL DAN PEMBAHASAN. Amplifikasi Daerah D-loop M B1 B2 B3 M1 M2 P1 P2 (-) HASIL DAN PEMBAHASAN Amplifikasi Daerah D-loop Amplifikasi daerah D-loop DNA mitokondria (mtdna) pada sampel DNA sapi Bali, Madura, Pesisir, Aceh, dan PO dilakukan dengan menggunakan mesin PCR Applied

Lebih terperinci

BAB 4 HASIL PERCOBAAN DAN BAHASAN

BAB 4 HASIL PERCOBAAN DAN BAHASAN 14 BAB 4 HASIL PERCOBAAN DAN BAHASAN Konfirmasi bakteri C. violaceum dan B. cereus dilakukan dengan pewarnaan Gram, identifikasi morfologi sel bakteri, sekuensing PCR 16s rdna dan uji kualitatif aktivitas

Lebih terperinci

HASIL DAN PEMBAHASAN Isolasi DNA Genomik Sengon

HASIL DAN PEMBAHASAN Isolasi DNA Genomik Sengon HASIL DAN PEMBAHASAN Isolasi DNA Genomik Sengon DNA genomik sengon diisolasi dari daun muda pohon sengon. Hasil uji integritas DNA metode 1, metode 2 dan metode 3 pada gel agarose dapat dilihat pada Gambar

Lebih terperinci

III. MATERI DAN METODE A.

III. MATERI DAN METODE A. III. MATERI DAN METODE A. Waktu dan Tempat Penelitian Penelitian ini dilaksanakan pada bulan September sampai dengan Desember 2015. Proses isolasi DNA, simplex-pcr dan duplex-pcr dilaksanakan di Sub Laboratorium

Lebih terperinci

IDENTIFIKASI KERAGAMAN GEN Growth Hormone PADA DOMBA EKOR TIPIS SUMATERA

IDENTIFIKASI KERAGAMAN GEN Growth Hormone PADA DOMBA EKOR TIPIS SUMATERA SKRIPSI IDENTIFIKASI KERAGAMAN GEN Growth Hormone PADA DOMBA EKOR TIPIS SUMATERA Oleh: Astri Muliani 11081201226 PROGRAM STUDI PETERNAKAN FAKULTAS PERTANIAN DAN PETERNAKAN UNIVERSITAS ISLAM NEGERI SULTAN

Lebih terperinci

MATERI DAN METODE. Materi

MATERI DAN METODE. Materi MATERI DAN METODE Lokasi dan Waktu Penelitian ini dilakukan di Laboratorium Genetika Molekuler Ternak, Bagian Pemuliaan dan Genetik Ternak, Departemen Ilmu Produksi dan Teknologi Peternakan, Fakultas Peternakan,

Lebih terperinci

STUDI HOMOLOGI DAERAH TERMINAL-C HASIL TRANSLASI INSCRIPTO BEBERAPA GEN DNA POLIMERASE I

STUDI HOMOLOGI DAERAH TERMINAL-C HASIL TRANSLASI INSCRIPTO BEBERAPA GEN DNA POLIMERASE I STUDI HOMOLOGI DAERAH TERMINAL-C HASIL TRANSLASI INSCRIPTO BEBERAPA GEN DNA POLIMERASE I T 572 MUL ABSTRAK DNA polimerase merupakan enzim yang berperan dalam proses replikasi DNA. Tiga aktivitas yang umumnya

Lebih terperinci

METODE PENELITIAN. Tabel 2. Rincian pengambilan contoh uji baik daun maupun kayu jati

METODE PENELITIAN. Tabel 2. Rincian pengambilan contoh uji baik daun maupun kayu jati METODE PENELITIAN Waktu dan Tempat Dalam penelitian ini contoh uji yang digunakan dibedakan atas contoh uji daun dan kayu. Penelitian terhadap daun dan kayu dilakukan di Ruang Analisis Genetika, Laboratorium

Lebih terperinci

BAB III. METODOLOGI PENELITIAN. Pengambilan sampel. Penyiapan templat mtdna dengan metode lisis sel

BAB III. METODOLOGI PENELITIAN. Pengambilan sampel. Penyiapan templat mtdna dengan metode lisis sel 16 BAB III. METODOLOGI PENELITIAN Bab ini menggambarkan tahapan penelitian yang terdiri dari pengambilan sampel, penyiapan templat mtdna dengan metode lisis sel, amplifikasi D-loop mtdna dengan teknik

Lebih terperinci

INDUKSI KERAGAMAN GENETIK DENGAN MUTAGEN SINAR GAMMA PADA NENAS SECARA IN VITRO ERNI SUMINAR

INDUKSI KERAGAMAN GENETIK DENGAN MUTAGEN SINAR GAMMA PADA NENAS SECARA IN VITRO ERNI SUMINAR INDUKSI KERAGAMAN GENETIK DENGAN MUTAGEN SINAR GAMMA PADA NENAS SECARA IN VITRO ERNI SUMINAR SEKOLAH PASCASARJANA INSTITUT PERTANIAN BOGOR BOGOR 2010 i ABSTRACT ERNI SUMINAR. Genetic Variability Induced

Lebih terperinci

IDENTIFIKASI KERAGAMAN GEN PITUITARY SPECIFIC POSITIVE TRANSCRIPTION FACTOR

IDENTIFIKASI KERAGAMAN GEN PITUITARY SPECIFIC POSITIVE TRANSCRIPTION FACTOR IDENTIFIKASI KERAGAMAN GEN PITUITARY SPECIFIC POSITIVE TRANSCRIPTION FACTOR 1 (PIT1) PADA KERBAU LOKAL (Bubalus bubalis) DAN SAPI FH (Friesian-Holstein) SKRIPSI RESTU MISRIANTI DEPARTEMEN ILMU PRODUKSI

Lebih terperinci

SKRIPSI. Oleh: ROSLINA HULU / AGROEKOTEKNOLOGI-BPP

SKRIPSI. Oleh: ROSLINA HULU / AGROEKOTEKNOLOGI-BPP ANALISIS KERAGAMAN GENETIK BAWANG MERAH (Allium ascalonicum L.) PADA BEBERAPA AKSESI DI SAMOSIR MENGGUNAKAN MARKA RAPD (Random Amplified Polymorphic DNA) SKRIPSI Oleh: ROSLINA HULU / 120301246 AGROEKOTEKNOLOGI-BPP

Lebih terperinci

III. MATERI DAN METODE. Fakultas Pertanian dan Peternakan Universitas Islam Negeri Sultan Syarif Kasim

III. MATERI DAN METODE. Fakultas Pertanian dan Peternakan Universitas Islam Negeri Sultan Syarif Kasim III. MATERI DAN METODE 3.1 Waktu dan Tempat Penelitian ini akan dilaksanakan di Laboratorium Genetika dan Pemuliaan Fakultas Pertanian dan Peternakan Universitas Islam Negeri Sultan Syarif Kasim Riau Pekanbaru

Lebih terperinci

BAB IV HASIL DAN PEMBAHASAN. tanaman mangga dengan menggunakan metode CTAB (cetyl trimethylammonium

BAB IV HASIL DAN PEMBAHASAN. tanaman mangga dengan menggunakan metode CTAB (cetyl trimethylammonium BAB IV HASIL DAN PEMBAHASAN 4.1 Ekstraksi DNA Analisis DNA dimulai dengan melakukan ekstraksi DNA total dari daun tanaman mangga dengan menggunakan metode CTAB (cetyl trimethylammonium bromide). CTAB merupakan

Lebih terperinci

Saintek Vol 5, No 6, Tahun 2010 POLYMERASE CHAIN REACTION (PCR) Zuhriana K.Yusuf

Saintek Vol 5, No 6, Tahun 2010 POLYMERASE CHAIN REACTION (PCR) Zuhriana K.Yusuf Saintek Vol 5, No 6, Tahun 2010 POLYMERASE CHAIN REACTION (PCR) Zuhriana K.Yusuf Staf Pengajar Jurusan Kesehatan Masyarakat FIKK Universitas Negeri Gorontalo Abstrak (Polymerase Chain Reaction, PCR) adalah

Lebih terperinci

DAFTAR ISI. Halaman HALAMAN PERSETUJUAN... iii PERNYATAAN... PRAKATA... INTISARI... ABSTRACT... DAFTAR ISI... DAFTAR TABEL... DAFTAR GAMBAR...

DAFTAR ISI. Halaman HALAMAN PERSETUJUAN... iii PERNYATAAN... PRAKATA... INTISARI... ABSTRACT... DAFTAR ISI... DAFTAR TABEL... DAFTAR GAMBAR... DAFTAR ISI Halaman HALAMAN PERSETUJUAN... iii PERNYATAAN... PRAKATA... INTISARI... ABSTRACT... DAFTAR ISI... DAFTAR TABEL... DAFTAR GAMBAR... DAFTAR LAMPIRAN... DAFTAR SINGKATAN... v vi viii ix x xiii

Lebih terperinci

I. PENDAHULUAN. A. Latar Belakang. Jeruk merupakan salah satu tanaman buah yang penting dan

I. PENDAHULUAN. A. Latar Belakang. Jeruk merupakan salah satu tanaman buah yang penting dan I. PENDAHULUAN A. Latar Belakang Jeruk merupakan salah satu tanaman buah yang penting dan dibudidayakan secara luas di Indonesia. Hal ini terlihat dari total produksi jeruk di Indonesia menduduki peringkat

Lebih terperinci

DAFTAR ISI Halaman HALAMAN JUDUL... i HALAMAN PENGESAHAN... KATA PENGANTAR... DAFTAR ISI... DAFTAR TABEL... DAFTAR GAMBAR... DAFTAR LAMPIRAN...

DAFTAR ISI Halaman HALAMAN JUDUL... i HALAMAN PENGESAHAN... KATA PENGANTAR... DAFTAR ISI... DAFTAR TABEL... DAFTAR GAMBAR... DAFTAR LAMPIRAN... DAFTAR ISI HALAMAN JUDUL... i HALAMAN PENGESAHAN... KATA PENGANTAR...... DAFTAR ISI... DAFTAR TABEL... DAFTAR GAMBAR... DAFTAR LAMPIRAN... INTISARI... ABSTRACT... PENDAHULUAN... 1 A. Latar Belakang...

Lebih terperinci

HASIL DAN PEMBAHASAN

HASIL DAN PEMBAHASAN HASIL DAN PEMBAHASAN Polimorfisme RAPD dan Mikrosatelit Penelitian ini menggunakan primer dari Operon Technology, dimana dari 10 primer acak yang diseleksi, primer yang menghasilkan pita amplifikasi yang

Lebih terperinci

HASIL DAN PEMBAHASAN. Hasil. dua lembar plastik transparansi dan semua sisinya direkatkan hingga rapat.

HASIL DAN PEMBAHASAN. Hasil. dua lembar plastik transparansi dan semua sisinya direkatkan hingga rapat. (Polyacrilamide Gel Elektroforesis) 5,5% pada tegangan 85 V selama 6 jam. Standar DNA yang digunakan adalah ladder (Promega) Gel polyacrilmide dibuat dengan menggunakan 30 ml aquades, 4 ml 10xTBE, 5,5

Lebih terperinci

II. MATERI DAN METODE. Tempat pengambilan sampel daun jati (Tectona grandis Linn. f.) dilakukan di

II. MATERI DAN METODE. Tempat pengambilan sampel daun jati (Tectona grandis Linn. f.) dilakukan di II. MATERI DAN METODE 2.1 Waktu dan Tempat Penelitian Tempat pengambilan sampel daun jati (Tectona grandis Linn. f.) dilakukan di enam desa yaitu tiga desa di Kecamatan Grokgak dan tiga desa di Kecamatan

Lebih terperinci

BAB III METODOLOGI PENELITIAN. Pada penelitian ini terdapat lima tahapan penelitian yang dilakukan yaitu

BAB III METODOLOGI PENELITIAN. Pada penelitian ini terdapat lima tahapan penelitian yang dilakukan yaitu BAB III METODOLOGI PENELITIAN Pada penelitian ini terdapat lima tahapan penelitian yang dilakukan yaitu pengumpulan sampel berupa akar rambut, ekstraksi mtdna melalui proses lisis akar rambut, amplifikasi

Lebih terperinci

Keanekaragaman Genetika Ikan Lais Cryptopterus spp. dari Propinsi Riau Berdasarkan Sitokrom-b DNA Mitokondria

Keanekaragaman Genetika Ikan Lais Cryptopterus spp. dari Propinsi Riau Berdasarkan Sitokrom-b DNA Mitokondria Ill Keanekaragaman Genetika Ikan Lais Cryptopterus spp. dari Propinsi Riau Berdasarkan Sitokrom-b DNA Mitokondria Yusnarti Yus' dan Roza Elvyra' 'Program Studi Biologi, Fakultas MIPA, Universitas Riau,

Lebih terperinci

TINJAUAN PUSTAKA Sapi Lokal Indonesia

TINJAUAN PUSTAKA Sapi Lokal Indonesia TINJAUAN PUSTAKA Sapi Lokal Indonesia Indonesia merupakan salah satu negara di Asia Tenggara yang memiliki banyak bangsa sapi dan hewan-hewan lainnya. Salah satu jenis sapi yang terdapat di Indonesia adalah

Lebih terperinci

EFFECTIVENESS OF RAPD AND SSR MARKERS FOR GENETIC ANALYSIS OF NINE PISIFERA OIL PALM (Elaeis guineensis Jacq.) ORIGINATED FROM NIGERIA.

EFFECTIVENESS OF RAPD AND SSR MARKERS FOR GENETIC ANALYSIS OF NINE PISIFERA OIL PALM (Elaeis guineensis Jacq.) ORIGINATED FROM NIGERIA. 20 EFFECTIVENESS OF RAPD AND SSR MARKERS FOR GENETIC ANALYSIS OF NINE PISIFERA OIL PALM (Elaeis guineensis Jacq.) ORIGINATED FROM NIGERIA Abstract The objectives of this experiment were to compare effectiveness

Lebih terperinci

BAB IV HASIL DAN PEMBAHASAN. telah banyak dilakukan sebelumnya menunjukkan bahwa fenomena munculnya

BAB IV HASIL DAN PEMBAHASAN. telah banyak dilakukan sebelumnya menunjukkan bahwa fenomena munculnya BAB IV HASIL DAN PEMBAHASAN Penelitian terhadap urutan nukleotida daerah HVI mtdna manusia yang telah banyak dilakukan sebelumnya menunjukkan bahwa fenomena munculnya rangkaian poli-c merupakan fenomena

Lebih terperinci

Laporan Tahunan 2015: Inovasi Pertanian Bioindustri Menuju Kedaulatan Pangan dan Kesejahteraan Petani

Laporan Tahunan 2015: Inovasi Pertanian Bioindustri Menuju Kedaulatan Pangan dan Kesejahteraan Petani 78 Laporan Tahunan 2015: Inovasi Pertanian Bioindustri Menuju Kedaulatan Pangan dan Kesejahteraan Petani Bioteknologi dan Sumber Daya Genetik Kemajuan teknologi genomika telah membuka khasanah baru dalam

Lebih terperinci

Metodologi Penelitian. Metode, bahan dan alat yang digunakan dalam penelitian ini akan dipaparkan pada bab ini.

Metodologi Penelitian. Metode, bahan dan alat yang digunakan dalam penelitian ini akan dipaparkan pada bab ini. Bab III Metodologi Penelitian Metode, bahan dan alat yang digunakan dalam penelitian ini akan dipaparkan pada bab ini. III.1 Rancangan Penelitian Secara garis besar tahapan penelitian dijelaskan pada diagram

Lebih terperinci

BAB IV HASIL DAN PEMBAHASAN. Isolasi DNA genom tanaman padi T0 telah dilakukan pada 118

BAB IV HASIL DAN PEMBAHASAN. Isolasi DNA genom tanaman padi T0 telah dilakukan pada 118 45 BAB IV HASIL DAN PEMBAHASAN A. HASIL Isolasi DNA genom tanaman padi T0 telah dilakukan pada 118 sampel. Berdasarkan hasil digesti DNA dengan enzim EcoRI, diperoleh sebanyak 74 sampel tanaman dari 118

Lebih terperinci

terkandung di dalam plasma nutfah padi dapat dimanfaatkan untuk merakit genotipe padi baru yang memiliki sifat unggul, dapat beradaptasi serta tumbuh

terkandung di dalam plasma nutfah padi dapat dimanfaatkan untuk merakit genotipe padi baru yang memiliki sifat unggul, dapat beradaptasi serta tumbuh PEMBAHASAN UMUM Kebutuhan pangan berupa beras di Indonesia terus meningkat seiring dengan peningkatan jumlah penduduk. Akan tetapi di masa datang kemampuan pertanian di Indonesia untuk menyediakan beras

Lebih terperinci

I. PENDAHULUAN. maupun luar negeri. Hingga saat ini jati masih menjadi komoditas mewah

I. PENDAHULUAN. maupun luar negeri. Hingga saat ini jati masih menjadi komoditas mewah I. PENDAHULUAN 1.1. Latar Belakang Jati (Tectona grandis Linn. f.) merupakan salah satu jenis kayu komersial yang memiliki nilai ekonomis tinggi dan diminati oleh banyak orang, baik dalam maupun luar negeri.

Lebih terperinci

BAB I PENDAHULUAN. Indonesia merupakan negara mega biodiversitas karena memiliki

BAB I PENDAHULUAN. Indonesia merupakan negara mega biodiversitas karena memiliki BAB I PENDAHULUAN 1.1 Latar Belakang Indonesia merupakan negara mega biodiversitas karena memiliki kawasan hutan tropika basah dengan tingkat keanekaragaman hayati yang tinggi di dunia. Keanekaragaman

Lebih terperinci

HASIL DAN PEMBAHASAN

HASIL DAN PEMBAHASAN HASIL DAN PEMBAHASAN Amplifikasi Gen Hormon Pertumbuhan (GH) Amplifikasi gen hormon pertumbuhan pada sapi FH yang berasal dari BIB Lembang, BBIB Singosari, dan BET Cipelang; serta sapi pedaging (sebagai

Lebih terperinci

BAB I PENDAHULUAN 1.1 Latar Belakang

BAB I PENDAHULUAN 1.1 Latar Belakang BAB I PENDAHULUAN 1.1 Latar Belakang Indonesia merupakan salah satu negara yang memiliki kekayaan hasil perikanan yang beranekaragam, sehingga mendatangkan devisa negara yang cukup besar terutama dari

Lebih terperinci

BAHAN DAN METODE Tempat dan Waktu Penelitian Bahan dan Alat

BAHAN DAN METODE Tempat dan Waktu Penelitian Bahan dan Alat 12 BAHAN DAN METODE Tempat dan Waktu Penelitian Survei penyakit klorosis dan koleksi sampel tanaman tomat sakit dilakukan di sentra produksi tomat di daerah Cianjur, Cipanas, Lembang, dan Garut. Deteksi

Lebih terperinci

BABm METODE PENELITIAN

BABm METODE PENELITIAN BABm METODE PENELITIAN 3.1 Jenis Penelitian Penelitian ini merupakan penelitian analitik dengan desain cross-sectioned, yaitu untuk mengetahui apakah terdapat perbedaan distnbusi genotipe dan subtipe VHB

Lebih terperinci

METODOLOGI PENELITIAN. Tempat dan Waktu Penelitian. Bahan dan Alat Penelitian

METODOLOGI PENELITIAN. Tempat dan Waktu Penelitian. Bahan dan Alat Penelitian 14 METODOLOGI PENELITIAN Tempat dan Waktu Penelitian Tempat penelitian dilakukan di Laboratorium Unit Pelayanan Mikrobiologi Terpadu, Bagian Mikrobiologi Kesehatan, Departemen Ilmu Penyakit Hewan dan Kesehatan

Lebih terperinci

KERAGAMAN Musa acuminata Colla LIAR DENGAN PENDEKATAN MORFOLOGI DAN MOLEKULER

KERAGAMAN Musa acuminata Colla LIAR DENGAN PENDEKATAN MORFOLOGI DAN MOLEKULER KERAGAMAN Musa acuminata Colla LIAR DENGAN PENDEKATAN MORFOLOGI DAN MOLEKULER SKRIPSI Diajukan untuk memenuhi salah satu syarat mencapai derajat Sarjana Sains (S.Si) Pada Jurusan Biologi Fakultas Matematika

Lebih terperinci

menggunakan program MEGA versi

menggunakan program MEGA versi DAFTAR ISI COVER... i HALAMAN PENGESAHAN... ii HALAMAN PERSEMBAHAN... iii PRAKATA... iv DAFTAR ISI... vi DAFTAR TABEL... viii DAFTAR GAMBAR... ix DAFTAR LAMPIRAN... x INTISARI... xi ABSTRACT... xii PENDAHULUAN...

Lebih terperinci

BAB III METODOLOGI PENELITIAN. Jenis penelitian yang digunakan adalah penelitian dasar dengan metode

BAB III METODOLOGI PENELITIAN. Jenis penelitian yang digunakan adalah penelitian dasar dengan metode 24 BAB III METODOLOGI PENELITIAN A. Jenis Penelitian Jenis penelitian yang digunakan adalah penelitian dasar dengan metode penelitian deskriptif. B. Objek Penelitian Empat spesies burung anggota Famili

Lebih terperinci

(A) 530C-550C; (B) 560C, 570C, 580C, 600C; (C) 590C, 610C, 620C; (D)

(A) 530C-550C; (B) 560C, 570C, 580C, 600C; (C) 590C, 610C, 620C; (D) 2 melawan mikroba. Peran flavonol dalam bidang kesehatan sebagai antiinflamatori, antioksidan, antiproliferatif, menekan fotohemolisis eritrosit manusia, dan mengakhiri reaksi rantai radikal bebas (Albert

Lebih terperinci

HALAMAN JUDUL HALAMAN PENGESAHAN PERNYATAAN KEASLIAN PENULISAN PRAKATA DAFTAR ISI DAFTAR GAMBAR DAFTAR TABEL DAFTAR LAMPIRAN INTISARI ABSTRACT BAB I

HALAMAN JUDUL HALAMAN PENGESAHAN PERNYATAAN KEASLIAN PENULISAN PRAKATA DAFTAR ISI DAFTAR GAMBAR DAFTAR TABEL DAFTAR LAMPIRAN INTISARI ABSTRACT BAB I DAFTAR ISI HALAMAN JUDUL... i HALAMAN PENGESAHAN... ii PERNYATAAN KEASLIAN PENULISAN... iii PRAKATA... iv DAFTAR ISI... vi DAFTAR GAMBAR... viii DAFTAR TABEL... ix DAFTAR LAMPIRAN... x INTISARI... xi ABSTRACT...

Lebih terperinci