MOLECULAR IDENTIFICATION BY USING POLYMERASE CHAIN REACTION (PCR) AND DNA SEQUENCING OF DIARRHEA BACTERIA PATHOGENS

Ukuran: px
Mulai penontonan dengan halaman:

Download "MOLECULAR IDENTIFICATION BY USING POLYMERASE CHAIN REACTION (PCR) AND DNA SEQUENCING OF DIARRHEA BACTERIA PATHOGENS"

Transkripsi

1 MOLECULAR IDENTIFICATION BY USING POLYMERASE CHAIN REACTION (PCR) AND DNA SEQUENCING OF DIARRHEA BACTERIA PATHOGENS IDENTIFIKASI MOLEKULAR DENGAN TEKNIK POLYMERASE CHAIN REACTION (PCR) DAN SEKUENSING DNA TERHADAP BAKTERI PATOGEN PENYEBAB DIARE Ety Supriyaningsih, Priyo Wahyudi, Supandi Fakultas Farmasi dan Sains Universitas Muhammadiyah Prof. Dr. Hamka Abstract Diarrhea caused by bacterial infections. Identification of pathogenic bacteria can be done by using molecular techniques. This research aims at detecting bacterial pathogens that cause diarrhea by the method of polymerase chain reaction (PCR ), using 16S rrna gene sequence analysis. Samples were extracted using the GeneJET Genomic DNA Purification Kit, then amplified by PCR using primers 63F and 1387r. Positive PCR results are indicated by the presence of DNA fragments in the electrophoresis gel in the area about 2500 base pairs. This result was followed by sequencing and alignment of data on Basic Local Alignment Search Tool (BLAST). BLAST alignment results Siloam Karawaci Hospitals with samples were known to have 99 % similarity with Escherichia coli O157 H:7. E. coli is a bacterium that is commonly found in patients with diarrhea. Keyword: PCR, DNA sequencing, 16S rrna gene Abstrak Diare dapat disebabkan oleh infeksi bakteri. Identifikasi bakteri patogen dapat dilakukan dengan menggunakan teknik molekuler. Penelitian ini dilakukan untuk mendeteksi bakteri patogen penyebab diare dengan metode polymerase chain reaction (PCR), menggunakan analisa sekuens gen 16S rrna. Sampel diekstraksi menggunakan GeneJET Genomic DNA Purification Kit, kemudian diamplifikasi dengan PCR menggunakan primer 63f dan 1387r. Hasil PCR positif ditunjukkan dengan adanya fragmen DNA pada gel elektroforesis pada daerah sekitar 2500 pasang basa. Hasil ini dilanjutkan dengan sekuensing dan penyejajaran data pada Basic Local Alignment Search Tool (BLAST). Penyejajaran menggunakan BLAST dari sampel yang diperoleh dari Rumah Sakit Siloam Karawaci Tanggerang-Banten diketahui memiliki 99% kemiripan dengan Escherichia coli O157 H:7. Bakteri E. coli merupakan bakteri yang sering terdapat pada penderita diare. Kata kunci: PCR, sekuensing DNA, Gen 16S rrna 1

2 PENDAHULUAN Diare merupakan penyakit disebabkan oleh infeksi bakteri. Bakteri-bakteri penyebab diare merupakan jenis bakteri Gram negatif diantaranya Campylobacter jejuni, Staphylococcus aureus, Bacillus cereus, Clostridium perfringen, Escherichia coli, Clostridium difficile, dan Vibrio cholera (Guerrant et al. 2001). Polymerase Chain Reaction (PCR) adalah salah satu teknik yang dapat melipatgandakan DNA secara in vitro dalam waktu singkat (Yuwono 2006). Proses PCR menggunakan sepasang primer, yang merupakan oligonukleotida yang berperan sebagai amplifikasi molekul DNA, kemudian dielektroforesis dan diidentifikasi menggunakan suatu gen penanda yaitu gen 16S rrna (Aris 2013). Gen 16S rrna merupakan gen yang bersifat spesifik terhadap spesies prokariot sehingga gen 16S rrna dapat digunakan untuk mempelajari hubungan filogenetik dari suatu spesies bakteri (Claridge 2004). Analisa sekuen akan menemukan secara jelas bahwa bakteri patogen tersebut bersifat spesifik terhadap bakteri-bakteri yang menyebabkan penyakit diare (Radji 2010). Analisis sekuen merupakan suatu teknik yang dianggap paling baik untuk melihat keanekaragaman hayati suatu kelompok organisme. Sekuensing DNA adalah suatu proses penentuan urutan basa suatu DNA. Proses ini menggunakan prinsip reaksi polimerisasi DNA secara enzimatis dengan penambahan suatu ddntp. Penyakit infeksi diare menjadi perhatian di Rumah Sakit Siloam Karawaci Tangerang, karena banyaknya jumlah pasien infeksi diare yang disebabkan oleh bakteri. Pada penelitian ini dilakukan identifikasi molekuler terhadap isolat bakteri patogen diare yang diperoleh dari pasien infeksi diare. Isolat bakteri yang didapat dari Rumah Sakit Siloam Karawaci Tanggerang Banten akan diamplifikasi dengan teknik PCR, selanjutnya dilakukan sekuensing terhadap gen 16S rrna. Sekuens yang didapat akan dilakukan penyejajaran menggunakan situs online NCBI atau EMBL. METODOLOGI Alat Penelitian Alat-alat yang digunakan adalah tabung reaksi, micropipet, tube sentrifius 2 ml, jarum ose, batang pengaduk, inkubator, autoklaf, laminar air flow, waterbath, microsentrifuge refrigenerator (Bio-Lion XC-HR 20), peltier thermo cycler (Tanach RAY MG48), elektroforesis (Mupid EXU), UV transiluminator (Extra Gene).. Bahan Penelitian 1. Bahan Isolasi DNA Genom Isolat bakteri diperoleh dari RS Siloam Tanggerang, ethanol 50%, 70%, 96% dan GeneJET Genomic DNA Purification Kit (Thermo Scientific), yang terdiri dari: lysis solution, digestion solution, proteinase K, RNAse solution, wash buffer I, wash bufer II, dan Elution bufer. 2. Bahan Kimia untuk PCR Forward primer (Genetika Science) 63f (5 -CAG GCC TAA CAC ATG CAA GTC-3 ) dan reverse primer (Genetika Science) 1387r (5 -GGG CGG WGT GTA CAA GGC-3) (Marchesi et al. 1998). Deionized demineralized water (Thermo 2

3 Scientific), PCR Master Mix 2x (Thermo Scientific), yang terdiri dari: Taq polimerase, PCR bufer, datp, dgtp, dttp, dctp, dan Mg Bahan Kimia untuk Elektroforesis Gel agarosa, loading dye (Thermo Scientific), etidium bromida, bufer Tris Borat EDTA (TBE) 1x, dan DNA Ladder 1 kb (Thermo Scientific). 4. Bahan untuk Pengkayaan Medium nutrient broth (NB) (Merck). Prosedur Kerja 1. Isolasi DNA Genom dengan GeneJET Kit Tahap awal yang dilakukan dalam penelitian meliputi persiapan alat dan bahan yang digunakan dalam penelitian. Alat-alat seperti tip dan tube sentrifius disterilkan terlebih dahulu dengan autoklaf suhu 121ºC selama 15 menit. Medium NB yang digunakan disterilisasi dengan autoklaf suhu 121ºC selama 15 menit, sedangkan sterilisasi dengan ethanol 70% digunakan untuk sterilisasi laminar air flow dan lingkungan di sekitar perlakuan, sterilisasi dengan pemanasan menggunakan Bunsen digunakan untuk jarum ose.isolat bakteri yang akan digunakan untuk proses isolasi, terlebih dahulu dikultur dalam medium nutrient broth dan diinkubasi jam pada suhu 37 o C. Proses isolasi dilakukan berdasarkan protokol yang terdapat pada GeneJET Genomic DNA Purification Kit. Sebanyak 1,5-2,0 ml kultur bakteri dipindahkan ke dalam tabung mikrosentrifus steril, kemudian disentrifugasi pada kecepatan 5000 x g selama 10 menit. Supernatan yang terbentuk dibuang dan jangan sampai ada sisa medium dalam tabung. Endapan sel bakteri kemudian ditambahkan dengan 20 μl Proteinase K dan 180 μl digestion solution dihomogenkan, lalu diinkubasi 30 menit pada suhu 56 o C sambil sesekali dihomogenkan. Tahap selanjutnya ditambahkan 20 μl RNAse solution lalu dihomogenkan dan diinkubasi suhu ruang selama 10 menit agar sel lisis dengan sempurna. Ditambahkan 200 μl lysis solution, dihomogenkan selama 15 detik lalu ditambahkan dengan 400 μl ethanol 50%, dihomogenkan kembali. Campuran tersebut dipindahkan ke kolom GeneJET Genomic DNA Purification yang dilengkapi dengan collection tube. Kolom disentrifugasi pada kecepatan 6000 x g selama 1 menit. Kemudian kolom GeneJET Genomic DNA Purification dipindahkan ke collection tube 2 ml baru. Pada kolom ditambahkan 500 μl wash bufer I yang telah ditambah dengan ethanol 96%, kemudian disentrifugasi pada kecepatan 8000 x g selama 1 menit. Collection tube dibuang lalu diganti dengan yang baru. Ditambahkan 500 μl wash bufer II yang sudah ditambahkan ethanol 96%, lalu disentrifugasi dengan kecepatan x g selama 3 menit. Jika terlihat larutan belum homogen, maka larutan dihomogenkan kembali selama 1 menit dengan kecepatan maksimum. Diambil larutan bagian bawah tube lalu pindahkan ke kolom GeneJET Genomic DNA Purification 1,5 ml steril. Terakhir, ditambahkan 200 μl elution bufer untuk melarutkan DNA genom. Kemudian diinkubasi selama 2 menit pada suhu ruang, dan disentrifugasi pada kecepatan 8000 x g selama 1 menit. Didapat DNA murni, lalu disimpan pada suhu _ 20 o C. 3

4 Selanjutnya adalah analisis DNA genom bakteri dengan menggunakan Elektroforesis. Untuk membuat agarosa dengan konsentrasi 1,6%, yaitu ditimbang agarosa sebanyak 0,80 g dalam 50 ml air suling steril, dan dididihkan hingga larut. Setelah agak dingin, larutan tersebut dituang pada cetakan gel, sisir dipasang, dan didiamkan hingga gel mengeras. Sisir diangkat dan nampan dipindahkan ke wadah elektroforesis. Wadah tersebut terlebih dahulu diberi bufer TBE 1x hingga menggenangi permukaan gel agarosa. Sebanyak 0,5 μl Loading dye ditambahkan pada 2,5 μl sampel DNA dan dihomogenkan. Campuran tersebut dimasukkan ke dalam cetakan sisir yang tersedia secara hati-hati. Elektroforesis dinyalakan dan tegangan diatur sebesar 100 volt. Kemudian, ditunggu hingga xylene cyanol mencapai 1 cm dari tepi bawah gel. Selanjutnya gel agarosa diambil dan dimasukkan ke dalam wadah yang sudah mengandung etidium bromida selama lima menit dalam ruangan gelap. Hasil diamati pada UV transiluminator pada panjang gelombang 500 nm dan fragmen DNA yang akan muncul didokumentasikan. Hasil positif ditandai dengan adanya fragmen DNA yang muncul pada gel agarosa. 2. Amplifikasi DNA Target dengan PCR Proses amplifikasi genom bakteri terhadap gen 16S rrna menggunakan primer 63f (5 -CAG GCC TAA CAC ATG CAA GTC-3 ) dan pimer 1387r (5 - GGG CGG WGT GTA CAA GGC-3 ) (Marchesi et al. 1998). Proses amplifikasi dilakukan berdasarkan protokol pada PCR Master Mix 2x. Dimasukkan sebanyak 25 μl PCR master mix 2x ke dalam microtube 0,5 ml, kemudian ditambahkan 15 μl deionized demineralized water (ddh2o) dan dihomogenkan. Primer 63f dan 1387r ditambahkan masing-masing sebanyak 2 μl, lalu dihomogenkan. Larutan tersebut dibagi menjadi dua bagian dengan dipipet sebanyak 22 μl dan dimasukkan ke dalam microtube 0,5 ml steril. Sebanyak 3 μl cetakan DNA ditambahkan ke dalam masingmasing microtube untuk memperoleh volume total 25 μl lalu dihomogenkan. Larutan tersebut di spindown dan dimasukkan ke dalam mesin PCR. Kondisi PCR diatur : Denaturasi awal pada suhu 94 o C selama 3 menit sebanyak 1 siklus, denaturasi pada suhu 94 o C selama 1 menit sebanyak 30 siklus, annealing pada suhu 55 o C selama 1 menit sebanyak 30 siklus, ekstensi pada suhu 72 o C selama 5 menit sebanyak 30 siklus dan ekstensi akhir pada suhu 72 o C selama 10 menit sebanyak 1 siklus (Prabu et al. 2010). Hasil amplifikasi dianalisis menggunakan elektroforesis gel agarosa 1,6 %. 3. Sekuensing Gen 16S rrna Amplikon dimasukkan ke dalam microtube 0,5 ml kering dan steril, kemudian diberi label dan disegel dengan parafilm untuk mencegah kebocoran dan perembesan. Sampel dikirim ke 1 st BASE Laboratories, Malaysia untuk selanjutnya dipurifikasi dan disekuensing. 4. Penyejajaran Hasil Sekuen dengan Menggunakan Program Online NCBI dan EMBL Sekuen DNA yang diperoleh dibandingkan dengan sekuen database pada situs EMBL dan NCBI. Lalu dilakukan penyejajaran terhadap persen kemiripannya dengan bakteri lain pada database. Hasilnya dapat dibuat untuk membuat pohon filogenetik. 4

5 Teknik Analisis Data Analisis data hasil deteksi PCR dengan dielektroforesis dan dianalisis berdasarkan ada tidaknya potongan pita DNA yang terbentuk, dan data disajikan secara deskriptif dalam bentuk tabel dan gambar. HASIL DAN PEMBAHASAN A. Isolasi DNA Bakteri Proses isolasi DNA merupakan tahapan awal dari seluruh rangkaian penelitian. Tahap pendahuluan bakteri dikultur dalam medium Nutrient Agar (NA) untuk melihat bentuk koloni bakteri yang terdapat dalam isolat murni. Koloni-koloni yang telah tumbuh selanjutnya dipindahkan dalam medium Nutrient Broth (NB) karena penggunaan medium cair akan memudahkan pada saat proses isolasi. Medium diinkubasi selama jam, menurut Sambrook and Russell (2001) pertumbuhan bakteri mencapai fase log akhir setelah diinkubasi semalam. Fase log akhir merupakan saat yang optimal untuk memanen bakteri, sehingga kuantitas DNA yang diperoleh maksimal. x Gambar 3. Bentuk koloni bulat bakteri Escherichia coli dari pasien Diare RS Siloam Tangerang dalam medium NA. Tanda x (koloni bulat). Setelah proses perbanyakan bakteri. Bakteri-bakteri dilakukan isolasi dan pemurnian DNA dengan menggunakan GeneJET Kit. Kegiatan isolasi DNA ini dilakukan untuk mendapatkan cetakan DNA yang murni dari masing-masing isolat. Proses isolasi DNA dilakukan sesuai dengan protokol yang terdapat pada GeneJET Genomic DNA Purification Kit. 5

6 M EO 1 x Gambar 4. Elektroforegram total genom DNA bakteri EO1 dari pasien diare RS Siloam Karawaci Tangerang Banten. Lajur M (marker), EO1 (DNA bakteri) dan x (pita DNA M EO 3 x Gambar 5. Elektroforegram total genom DNA bakteri EO3 dari pasien diare RS Siloam Karawaci Tangerang Banten. Lajur M (marker), EO3 (DNA bakteri) dan x (pita DNA). Dari kesepuluh isolat yang diperoleh dari rumah sakit, setelah dilakukan isolasi hanya didapatkan dua isolat murni DNA bakteri. Yaitu sampel EO1 dan EO3. Hal ini disebabkan pada saat memvisualisasikan dengan UV Transiluminator, Bentuk DNA yang diperoleh memiliki tingkat kemurnian yang baik pada sampel tersebut dengan ditandai munculnya bentuk pita tunggal atau pita DNA yang tidak berekor. Menurut Herison dkk. (2003) kualitas DNA yang baik yaitu tidak terdapat pola DNA yang terdegradasi pada saat visualisasi gel agarosa, sehingga DNA ini dapat dilanjutkan untuk amplifikasi dengan PCR. B. Amplifikasi Gen 16S rrna Bakteri Amplifikasi DNA dilakukan menggunakan metode PCR dengan primer 63f (5 -CAG GCC TAA CAC ATG CAA GTC-3 ) dan primer 1387r (5 -GGG CGG WGT GTA CAA GGC-3) (Marchesi et al. 1998). 6

7 M EO 3 x Gambar 6. Elektroforegram amplikon Gen 16S rrna bakteri Escherichia coli EO3 dari pasien diare RS Siloam Karawaci Tangerang Banten. Lajur M (marker), EO3 (DNA bakteri) dan x (pita DNA). M EO 1 x Gambar 7. Elektroforegram amplikon Gen 16S rrna bakteri Escherichia coli EO1 dari pasien diare RS Siloam Karawaci Tangerang Banten. Lajur M (marker), EO1 (DNA bakteri) dan x (pita DNA). Proses amplifikasi dimulai dengan denaturasi awal pada suhu 94 o C selama tiga menit, yang bertujuan untuk mempersiapkan untai DNA yang akan didenaturasi. Denaturasi pada suhu 94 o C selama satu menit bertujuan untuk memisahkan untai ganda DNA. Annealing pada suhu 55 o C selama satu menit untuk memberi waktu pada primer untuk menempel pada daerah tertentu dari target DNA. Proses ekstensi pada suhu 72 o C selama lima menit dilakukan dengan tujuan untuk memperpanjang gen 16S rrna. Ekstensi akhir pada suhu 72 o C yang bertujuan untuk menyempurnakan proses penggabungan untai DNA. Proses denaturasi, annealing, dan ekstensi dilakukan sebanyak 30 siklus bertujuan untuk melipatgandakan amplikon, agar saat dilakukan sekuensing jumlah DNA dapat terbaca pada mesin DNA sequencer. 7

8 Visualisasi gambar 7 (EO1) memiliki bentuk smear yang panjang dan terlihat sangat jelas. Hal ini menunjukkan, DNA yang teramplifikasi menunjukkan kualitas DNA kurang baik. Kualitas ini dapat dipengaruhi oleh konsentrasi primer, dntp dan MgCl2 yang digunakan. Menurut Henegariu et al. (1997) konsentrasi primer yang kurang baik dapat menyebabkan primer menempel pada sekuen yang tidak diinginkan dan dapat menyebabkan proses PCR tidak berjalan efisien, sehingga menghasilkan produk yang kurang baik. Pada EO3 muncul pita tunggal, sehingga didapat produk DNA target dengan kualitas baik, sehingga EO3 dapat dilakukan sekuensing DNA dengan mesin DNA sequencer. C. Analisis Hasil Sekuensing Analisis bioinformatika merupakan suatu analisis dengan meng-input data hasil sekuens ( query) pada program resmi di GenBank. Analisis dilakukan dengan menggunakan dua program online yaitu pada situs dan Sebelum dianalisis dengan program tersebut sebaiknya data hasil sekuens dilakukan analisa untuk melihat bentuk puncak atau elektroforegram yang didapat. Gambar 8. Elektroforegram sekuens Gen 16S rrna dari bakteri Escherichia coli pasien diare RS Siloam Karawaci Tangerang Banten menggunakan primer 1387r Gambar 9. Elektroforegram sekuens Gen 16S rrna dari bakteri Escherichia coli pasien diare RS Siloam Karawaci Tangerang Banten menggunakan primer 63f 8

9 Berdasarkan gambar 8 didapat lambang N pada proses pembacaan awal dengan mesin sequencer. Lambang N merupakaan suatu bentuk analisis yang tidak cukup jelas untuk menujukkan keberadaan basa A, C, G, atau T, sehingga harus dihilangkan terlebih dahulu dengan menggunakan program BioEdit. Data yang diperoleh dari program BioEdit berupa data hasil consensus antara primer forward dan primer reverse. Consensus merupakan suatu program yang terdapat pada BioEdit yang digunakan untuk mengontruksi kembali rangkaian urutan DNA yang saling tumpang tindih menjadi bentuk yang tunggal, sehingga dapat dilakukan ke tahap selanjutnya yaitu analisis di GenBank pada program Basic Local Alignment Search Tool (BLAST). Gambar 10. Hasil BLASTN dari sekuens Gen 16S rrna bakteri pasien diare RS Siloam Karawaci Tangerang Banten. Dari hasil BLAST dengan NCBI didapatkan data berupa garis-garis bewarna merah (gambar 10). Hasil ini menunjukkan suatu skala pada tingkat kesamaan sekuens-sekuens yang telah disejajarkan. Hasilnya menunjukkan garis-garis bewarna merah yang berarti kedua sekuens forward maupun reverse pada 16S rrna memiliki tingkat kemiripan yang sangat mirip yaitu lebih dari 200 nukleotida. Warna merah pada hasil menunjukkan bahwa data hasil BLAST valid, karena jika datanya kurang bagus akan ditunjukkan dengan warna biru sampai hitam. 9

10 Gambar 11. Hasil BLASTN dari sekuens Gen 16S rrna bakteri pasien diare RS Siloam Karawaci Tangerang Banten. Gambar 11 merupakan kelanjutan dari hasil BLASTN, dari data tersebut didapatkan bahwa sampel isolat memiliki persen kemiripan 99% pada jenis bakteri Escherichia coli O157:H7 Str Sakai. Nilai E-value yang dihasilkan adalah nol, nilai nol ini menunjukkan sekuens homolog dengan sekuens yang terdapat di GenBank. Hasil ini sesuai dengan penelitian yang dilakukan oleh (Sugianto 2007) yang dilakukan secara mikrobiologi bahwa bakteri utama yang terdapat pada penderita diare adalah jenis bakteri Escherichia coli. Hasil penelitian yang dilakuan secara molekuler maupun penelitian secara mikrobiologi telah didapatkan hasil yang sama, tetapi penelitian secara molekuler memiliki hasil yang lebih jelas karena terlihat sampai pada tingkatan strain bakteri tersebut, sedangkan tidak didapatkan pada penelitian yang dilakukan secara mikrobiologi 10

11 Gambar 12. Hasil BLASTN dari sekuens Gen 16S rrna bakteri pasien diare RS Siloam Karawaci Tangerang Banten. Dari gambar 12 didapat bahwa terdapat garis-garis penghubung antara sekuens yang di atas dengan sekuens yang di bawah. Garis ini menunjukkan terdapat kesesuaian antara sekuens forward 16S dengan sekuens reverse 16S. Sekuens tersebut memiliki kesamaan 99% dengan bakteri Escherichia coli serta ada bagianbagian yang tak terhubung pada garis, menunjukkan adanya perbedaan dari kedua sekuens tersebut pada saat proses penyejajaran. Data sekuens gen 16S rrna dari sampel isolat kemudian dibandingkan dengan beberapa data sekuen gen 16S rrna dari beberapa spesies E.coli lainnya. Hasil perbandingan sekuen ini kemudian divisualisasikan dalam bentuk pohon filogenetik yang dapat menunjukkan hubungan kekerabatan antara satu galur E.coli dengan galur yang lainnya. Pohon filogenetik membuat percabangan yang berupa akar dan cabang. Akar pohon merupakan titik yang bertindak sebagai nenek moyang, sedangkan cabang merupakan titik yang menjelaskan tentang spesies-spesies yang saling memiliki hubungan kekerabatan. Makin dekat cabang, maka hubungan antar spesies itu semakin dekat (Baldauf 2003). 11

12 Shigella sonnei Ss S ribosomal RNA, complete Escherichia coli O157:H7 str Sakai 16S ribosomal RNA, complete sequence EO 3 Escherichia coli str K-12 MG S ribosomal RNA, complete sequence Shigella dysentriae Sd197 16S ribosomal RNA, complete sequence Shigella dysentriae strain ATCC S ribosomal RNA, complete sequence Gambar 13. Cladogram bakteri Escherichia coli O105 H:7 str sakai pasien diare RS Siloam Karawaci Tangerang Banten. Tanda panah: sampel EO3 Pohon filogenetik selain menunjukkan kekerabatan antar spesies yang diperbandingkan, juga menggambarkan perubahan yang terjadi pada gen penanda untuk masing-masing spesies. Semakin panjang suatu cabang artinya semakin banyak perubahan yang terjadi pada gen penanda selama proses evolusi, akibatnya spesies yang berada pada cabang tersebut dapat dikatakan lebih maju. Cladogram merupakan cara yang dipakai untuk mempresentasikan pohon filogenetik (Baldauf 2003). Dari cladogram diketahui sampel EO3 memiliki hubungan yang dekat dengan spesies Escherichia coli str K-12 MG Dari hasil penyejajaran dengan menggunakan BLAST pada situs NCBI didapat bahwa sampel adalah bakteri jenis Escherichia coli O157: H7. Diketahui bakteri ini yang sering terdapat pada penderita diare. Escherichia coli O157: H7 adalah strain enterohemorrhagic (penyebab diare dan kolitis/pendarahan pada dinding kolon). (Obrig 2010). SIMPULAN Identifikasi bakteri patogen penyebab diare berhasil dilakukan dengan menggunakan teknik PCR. Tahap awal isolasi dengan menggunakan GeneJET Genomic DNA Purification Kit dihasilkan suatu produk DNA yang murni dengan ditunjukkan munculnya pita tunggal pada elektroforesis gel agarosa. Hasil amplifikasi dengan PCR didapatkan ukuran DNA sekitar 2500 pasang basa. Hasil sekuensing dan penyejajaran Gen 16S rrna yang dilakukan dengan program online NCBI dan EMBL menyatakan bahwa sampel memiliki kemiripan 99% dengan bakteri Escherichia coli O157 H:7. Bakteri tersebut diketahui menjadi penyebab utama penyakit diare. 12

13 DAFTAR PUSTAKA Aris M, Sukenda, Harris E, Sukadi MF, Yuhana M Identifikasi Molekuler Bakteri Patogen dan Desain Primer PCR. Jurnal Budidaya Perairan. Vol 1 No 3 Halm Baldauf SL Phylogeny for the faint of heart:a tutorial. Journal of Biology. No.6 Halm Clarridge JE Impact of 16S rrna Gene Sequence Analysis for Identification of Bacteria on Clinical Microbiology and Infectious Diseases. Journal Clinical Microbiology Reviews. Vol 17 Halm Guerrant RL, Van Gilder T, Steiner TS, Thielman NM, Slutsker L, Tauxe RV, Hennessy T, Griffin PM, Dupont H, Sack RB, Tarr P, Neill M, Nachamkin I, Reller LB, Osterholm MT, Bennish ML, Pickering LK Practice Guidlines for the Management of Infectious Diarrhea. Journal Clinical Infectious Deseases. Vol 32 Halm Henegariu O, Heerema NA, Dlouhy SR, Vance GH, Vogh PH Multiplex PCR: Critical Parameters and Step-By-Step Protocol. Biomolecular Techniques. Halm Herison C, Rustikawati, Eliyanti Penentuan Protokol yang Tepat untuk Menyiapkan DNA Genom Cabai (Capsicum sp). Jurnal Akta Agrosia. Vol 6. Halm Marchesi JR, Takuichi S, Weightman AJ, Martin TA, Fry JC, Hiom SJ, Wade WG Design and Evaluation of Useful Bacterium-Specific PCR Primers That Amplify Genes Coding for Bacterial 16S rrna. Journal Applied and Environmental Microbiology.Vol 64 Halm Prabhu V, Isloor S, Balu M, Suryanarayana VVS, Rathnamma D Genotyping by ERIC-PCR of Escherichia coli Isolated from Bovine Mastitis Cases. Journal of Biotechnology. Vol 9 Halm Radji M, Puspaningrum A, Sumiati A Deteksi Cepat Bakteri Escherichia coli dalam Sampel Air dengan Metode Polymerase Chain Reaction Menggunakan Primer 16E1 Dan 16E2. Makara Vol 14 Halm Sambrook J, Russell DW Molecular cloning a laboratory Manual. Cold Spring Harbor Laboratory Press. New York. Sugianto E Etiologi Diare Akut Infektif Di Puskesmas Mranggen dan Karangawen Kabupaten Demak. Bagian penyakit Dalam fakultas kedokteran UNDIP RSUP Dr. Kariadi Semarang. Obrig TG Escherichia coli Shiga Toxin Mechanisms of Action in Renal Disease. Journal Toxins Department of Microbiology and Immunology. Halm Yuwono T Teori Dan Aplikasi Polymerase Chain Reaction. Andy Publisher, Yogyakarta. Halm

MATERI DAN METODE. Kota Padang Sumatera Barat pada bulan Oktober Amplifikasi gen Growth

MATERI DAN METODE. Kota Padang Sumatera Barat pada bulan Oktober Amplifikasi gen Growth III. MATERI DAN METODE 3.1 Waktu dan Tempat Pengambilan sampel darah domba dilakukan di Kecamatan Koto Tengah Kota Padang Sumatera Barat pada bulan Oktober 2012. Amplifikasi gen Growth Hormone menggunakan

Lebih terperinci

BAB III BAHAN DAN METODE

BAB III BAHAN DAN METODE BAB III BAHAN DAN METODE 3.1. Tempat dan Waktu Penelitian 3.1.1. Tempat Penelitian Penelitian dilaksanakan di Laboratorium Bioteknologi Perikanan dan Kelautan Fakultas Perikanan dan Ilmu Kelautan Universitas

Lebih terperinci

BAB III METODE PENELITIAN Bagan Alir Penelitian ini secara umum dapat digambarkan pada skema berikut:

BAB III METODE PENELITIAN Bagan Alir Penelitian ini secara umum dapat digambarkan pada skema berikut: BAB III METODE PENELITIAN Tahapan-tahapan yang dilakukan dalam penelitian ini adalah: pengumpulan sampel, lisis terhadap sampel mtdna yang telah diperoleh, amplifikasi daerah HVI mtdna sampel dengan menggunakan

Lebih terperinci

BAB III METODOLOGI PENELITIAN. Pada penelitian ini terdapat lima tahapan penelitian yang dilakukan yaitu

BAB III METODOLOGI PENELITIAN. Pada penelitian ini terdapat lima tahapan penelitian yang dilakukan yaitu BAB III METODOLOGI PENELITIAN Pada penelitian ini terdapat lima tahapan penelitian yang dilakukan yaitu pengumpulan sampel berupa akar rambut, ekstraksi mtdna melalui proses lisis akar rambut, amplifikasi

Lebih terperinci

FAKULTAS BIOLOGI LABORATORIUM GENETIKA & PEMULIAAN INSTRUKSI KERJA UJI

FAKULTAS BIOLOGI LABORATORIUM GENETIKA & PEMULIAAN INSTRUKSI KERJA UJI Halaman : 1 dari 5 ISOLASI TOTAL DNA HEWAN DENGAN KIT EKSTRAKSI DNA 1. RUANG LINGKUP Metode ini digunakan untuk mengisolasi DNA dari sampel jaringan hewan, dapat dari insang, otot, darah atau jaringan

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN 3.1 Waktu dan Tempat Penelitian ini dilaksanakan pada bulan Januari 2012 sampai bulan Juli 2012, yang bertempat di Laboratorium Genetika dan Biologi Molekuler Jurusan Biologi

Lebih terperinci

BAHAN DAN METODE Tempat dan Waktu Penelitian Bahan dan Alat

BAHAN DAN METODE Tempat dan Waktu Penelitian Bahan dan Alat 12 BAHAN DAN METODE Tempat dan Waktu Penelitian Survei penyakit klorosis dan koleksi sampel tanaman tomat sakit dilakukan di sentra produksi tomat di daerah Cianjur, Cipanas, Lembang, dan Garut. Deteksi

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN 25 BAB III METODE PENELITIAN 3.1 Waktu dan Tempat Penelitian telah berlangsung sejak bulan Januari 2012 - Juli 2012 di Laboratorium Mikrobiologi, Lab. Optik, Lab. Genetika dan Lab. Biologi Molekuler Jurusan

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN A. Jenis Penelitian Jenis penelitian yang digunakan adalah penelitian dasar dengan metode deskriptif (Nazir, 1983). B. Populasi dan Sampel Populasi dalam penelitian ini adalah

Lebih terperinci

BAB XII. REAKSI POLIMERISASI BERANTAI

BAB XII. REAKSI POLIMERISASI BERANTAI BAB XII. REAKSI POLIMERISASI BERANTAI Di dalam Bab XII ini akan dibahas pengertian dan kegunaan teknik Reaksi Polimerisasi Berantai atau Polymerase Chain Reaction (PCR) serta komponen-komponen dan tahapan

Lebih terperinci

Metodologi Penelitian. Metode, bahan dan alat yang digunakan dalam penelitian ini akan dipaparkan pada bab ini.

Metodologi Penelitian. Metode, bahan dan alat yang digunakan dalam penelitian ini akan dipaparkan pada bab ini. Bab III Metodologi Penelitian Metode, bahan dan alat yang digunakan dalam penelitian ini akan dipaparkan pada bab ini. III.1 Rancangan Penelitian Secara garis besar tahapan penelitian dijelaskan pada diagram

Lebih terperinci

4 Hasil dan Pembahasan

4 Hasil dan Pembahasan 4 Hasil dan Pembahasan Dalam bab ini akan dipaparkan hasil dari tahap-tahap penelitian yang telah dilakukan. Melalui tahapan tersebut diperoleh urutan nukleotida sampel yang positif diabetes dan sampel

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN A. Jenis Penelitian Penelitian ini merupakan penelitian murni yang dilakukan dengan metode deskriptif, yaitu suatu metode penelitian untuk membuat deskripsi, gambaran atau lukisan

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN 3.1 Tempat dan Waktu Penelitian Kegiatan penelitan ini meliputi kegiatan kultivasi kandidat bakteri probiotik dari saluran pencernaan ikan sidat (Anguilla bicolor), uji aktivitas

Lebih terperinci

LAPORAN II (ISOLASI DNA GENOM)

LAPORAN II (ISOLASI DNA GENOM) LAPORAN PRAKTIKUM REKAYASA GENETIKA LAPORAN II (ISOLASI DNA GENOM) KHAIRUL ANAM P051090031/BTK BIOTEKNOLOGI SEKOLAH PASCASARJANA INSTITUT PERTANIAN BOGOR 2010 0 ISOLASI DNA GENOM TUJUAN 16s rrna. Praktikum

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN 3.1 Rancangan Penelitian Penelitian tentang Karakterisasi genetik Udang Jari (Metapenaeus elegans De Man, 1907) hasil tangkapan dari Laguna Segara Anakan berdasarkan haplotipe

Lebih terperinci

II. METODE PENELITIAN

II. METODE PENELITIAN II. METODE PENELITIAN 1. Materi, Lokasi, dan Waktu Penelitian 1.1. Materi Alat yang digunakan dalam penelitian ini adalah botol sampel, cawan petri, tabung reaksi, labu Erlenmeyer, beaker glass, object

Lebih terperinci

Saintek Vol 5, No 6, Tahun 2010 POLYMERASE CHAIN REACTION (PCR) Zuhriana K.Yusuf

Saintek Vol 5, No 6, Tahun 2010 POLYMERASE CHAIN REACTION (PCR) Zuhriana K.Yusuf Saintek Vol 5, No 6, Tahun 2010 POLYMERASE CHAIN REACTION (PCR) Zuhriana K.Yusuf Staf Pengajar Jurusan Kesehatan Masyarakat FIKK Universitas Negeri Gorontalo Abstrak (Polymerase Chain Reaction, PCR) adalah

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN A. Jenis penelitian Jenis penelitian ini adalah penelitian deskriptif yang mengangkat fenomena alam sebagai salah satu masalah dalam penelitian, sehingga dapat menerangkan arti

Lebih terperinci

3 METODOLOGI 3.1 Waktu dan Tempat 3.2 Bahan dan Alat

3 METODOLOGI 3.1 Waktu dan Tempat 3.2 Bahan dan Alat 3 METODOLOGI 3.1 Waktu dan Tempat Penelitian dilakukan selama bulan Januari hingga April 2010 bertempat di Laboratorium Karakteristik Bahan Baku, Departemen Teknologi Hasil Perairan, Fakultas Perikanan

Lebih terperinci

BAB I PENDAHULUAN. Penggunaan mikroorganisme antagonis sebagai agen pengendali hayati

BAB I PENDAHULUAN. Penggunaan mikroorganisme antagonis sebagai agen pengendali hayati BAB I PENDAHULUAN A. Latar Belakang Penggunaan mikroorganisme antagonis sebagai agen pengendali hayati memberikan harapan baru untuk pengendalian hama pertanian terutama fungi yang bersifat patogen. Secara

Lebih terperinci

molekul-molekul agarose. Proses elektroforesis diawali dengan pembuatan gel sebagai medianya yaitu agarose dilarutkan ke dalam TAE 10 X 50 ml yang

molekul-molekul agarose. Proses elektroforesis diawali dengan pembuatan gel sebagai medianya yaitu agarose dilarutkan ke dalam TAE 10 X 50 ml yang Tujuan dari praktikum ini adalah untuk mengisolasi DNA genom yang berasal dari darah sapi segar. Selanjutnya hasil dari isolasi tersebut akan diimplifikasikan dengan teknik in- vitro menggunakan PCR (Polimerase

Lebih terperinci

BAB IV HASIL DAN PEMBAHASAN. A. ISOLASI DNA GENOM PADI (Oryza sativa L.) KULTIVAR ROJOLELE,

BAB IV HASIL DAN PEMBAHASAN. A. ISOLASI DNA GENOM PADI (Oryza sativa L.) KULTIVAR ROJOLELE, BAB IV HASIL DAN PEMBAHASAN A. ISOLASI DNA GENOM PADI (Oryza sativa L.) KULTIVAR ROJOLELE, NIPPONBARE, DAN BATUTEGI Isolasi DNA genom padi dari organ daun padi (Oryza sativa L.) kultivar Rojolele, Nipponbare,

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN A. Jenis penelitian Jenis penelitian yang dilakukan adalah penelitian dasar dengan metode deskriptif (Nazir, 1988). B. Populasi dan sampel Populasi pada penelitian ini adalah

Lebih terperinci

DAFTAR ISI DAFTAR TABEL... DAFTAR GAMBAR... DAFTAR LAMPIRAN...

DAFTAR ISI DAFTAR TABEL... DAFTAR GAMBAR... DAFTAR LAMPIRAN... DAFTAR ISI Bab Halaman DAFTAR TABEL... DAFTAR GAMBAR... DAFTAR LAMPIRAN... ix x xii I II III PENDAHULUAN 1.1 Latar Belakang... 1 1.2 Identifikasi Masalah... 2 1.3 Tujuan Penelitian... 2 1.4 Kegunaan Penelitian...

Lebih terperinci

ANALISA HASIL TRANSFORMASI DENGAN MENGGUNAKAN PCR KOLONI DAN RESTRIKSI

ANALISA HASIL TRANSFORMASI DENGAN MENGGUNAKAN PCR KOLONI DAN RESTRIKSI 1 ANALISA HASIL TRANSFORMASI DENGAN MENGGUNAKAN PCR KOLONI DAN RESTRIKSI PENDAHULUAN Polimerase Chain Reaction (PCR) PCR adalah suatu reaksi invitro untuk menggandakan jumlah molekul DNA pada target tertentu

Lebih terperinci

Bab III Metode Penelitian

Bab III Metode Penelitian Bab III Metode Penelitian Metode yang dilakukan dalam penelitian ini terdiri dari empat tahapan, dimulai dengan pengumpulan sampel, kemudian lysis sel untuk mendapatkan template DNA, amplifikasi DNA secara

Lebih terperinci

BAB 4 HASIL PERCOBAAN DAN BAHASAN

BAB 4 HASIL PERCOBAAN DAN BAHASAN 14 BAB 4 HASIL PERCOBAAN DAN BAHASAN Konfirmasi bakteri C. violaceum dan B. cereus dilakukan dengan pewarnaan Gram, identifikasi morfologi sel bakteri, sekuensing PCR 16s rdna dan uji kualitatif aktivitas

Lebih terperinci

LAPORAN PRAKTIKUM REKAYASA GENETIKA

LAPORAN PRAKTIKUM REKAYASA GENETIKA LAPORAN PRAKTIKUM REKAYASA GENETIKA LAPORAN IV (ISOLASI RNA DARI TANAMAN) KHAIRUL ANAM P051090031/BTK BIOTEKNOLOGI SEKOLAH PASCASARJANA INSTITUT PERTANIAN BOGOR 2010 0 ISOLASI RNA DARI TANAMAN TUJUAN Tujuan

Lebih terperinci

METODE PENELITIAN. Tempat dan Waktu. Bakteri Uji. Bahan dan Media

METODE PENELITIAN. Tempat dan Waktu. Bakteri Uji. Bahan dan Media 39 METODE PENELITIAN Tempat dan Waktu Penelitian dilakukan di Laboratorium Patogen dan Bioteknologi Pangan (Southeast Asian Food and Agricultural Science and Technology) SEAFAST Center, Institut Pertanian

Lebih terperinci

LAPORAN PRAKTIKUM REKAYASA GENETIKA

LAPORAN PRAKTIKUM REKAYASA GENETIKA LAPORAN PRAKTIKUM REKAYASA GENETIKA LAPORAN II (ISOLASI DNA GENOM) KHAIRUL ANAM P051090031/BTK BIOTEKNOLOGI SEKOLAH PASCASARJANA INSTITUT PERTANIAN BOGOR 2010 0 ISOLASI DAN IDENTIFIKASI DNA SEL MUKOSA

Lebih terperinci

BAB 3 PERCOBAAN 3.1 Bahan 3.2 Alat

BAB 3 PERCOBAAN 3.1 Bahan 3.2 Alat BAB 3 PERCOBAAN 3.1 Bahan Bahan yang digunakan memiliki kualitas pro analisis atau pro biologi molekular, yaitu : primer M. tuberculosis forward: 5 GGATCCGATGAGCAAGCTGATCGAA3 (Proligo) dan primer M. tuberculosis

Lebih terperinci

BAB IV HASIL DAN PEMBAHASAN. Sintesis fragmen gen HA Avian Influenza Virus (AIV) galur

BAB IV HASIL DAN PEMBAHASAN. Sintesis fragmen gen HA Avian Influenza Virus (AIV) galur 20 BAB IV HASIL DAN PEMBAHASAN A. KONDISI OPTIMAL REAKSI AMPLIFIKASI Sintesis fragmen 688--1119 gen HA Avian Influenza Virus (AIV) galur A/Indonesia/5/2005 dilakukan dengan teknik overlapping extension

Lebih terperinci

BAB 4 HASIL PERCOBAAN DAN BAHASAN. Oligonukleotida sintetis daerah pengkode IFNα2b sintetis dirancang menggunakan

BAB 4 HASIL PERCOBAAN DAN BAHASAN. Oligonukleotida sintetis daerah pengkode IFNα2b sintetis dirancang menggunakan BAB 4 HASIL PERCOBAAN DAN BAHASAN Oligonukleotida sintetis daerah pengkode IFNα2b sintetis dirancang menggunakan program komputer berdasarkan metode sintesis dua arah TBIO, dimana proses sintesis daerah

Lebih terperinci

BAB III METODE A. Jenis Penelitian B. Populasi dan Sampel C. Waktu dan Lokasi Penelitian D. Alat dan Bahan Rizki Indah Permata Sari,2014

BAB III METODE A. Jenis Penelitian B. Populasi dan Sampel C. Waktu dan Lokasi Penelitian D. Alat dan Bahan Rizki Indah Permata Sari,2014 34 BAB III METODE A. Jenis Penelitian Penelitian ini merupakan penelitian murni atau pure research yang dilakukan dengan metode deskriptif, yaitu suatu metode penelitian untuk membuat deskripsi, gambaran

Lebih terperinci

METODE PENELITIAN. Bahan Penelitian

METODE PENELITIAN. Bahan Penelitian 35 METODE PENELITIAN Tempat dan Waktu Penelitian Metode yang digunakan dalam penelitian ini adalah metode eksperimen laboratorium. Penelitian ini dilakukan di Laboratorium Riset Fakultas Teknobiologi UNIKA

Lebih terperinci

PETUNJUK PRAKTIKUM BIOLOGI SEL DAN MOLEKULER Oleh: Ixora Sartika M ISOLASI DNA PLASMID

PETUNJUK PRAKTIKUM BIOLOGI SEL DAN MOLEKULER Oleh: Ixora Sartika M ISOLASI DNA PLASMID PETUNJUK PRAKTIKUM BIOLOGI SEL DAN MOLEKULER Oleh: Ixora Sartika M ixomerc@uny.ac.id ISOLASI DNA PLASMID Plasmid adalah DNA ekstrakromosom yang berbentuk sirkuler dan berukuran kecil (1 200 kb). Sebagian

Lebih terperinci

1 0,53 0,59 2 0,3 0,2 3 0,02 0,02 4 0,04 0,04 5 0,3 0,3 Ilustrasi rangkaian isolasi DNA tersebut dapat dilihat pada Gambar 1 berikut.

1 0,53 0,59 2 0,3 0,2 3 0,02 0,02 4 0,04 0,04 5 0,3 0,3 Ilustrasi rangkaian isolasi DNA tersebut dapat dilihat pada Gambar 1 berikut. PERBANDINGAN BEBERAPA METODE ISOLASI DNA UNTUK PENENTUAN KUALITAS LARUTAN DNA TANAMAN SINGKONG (Manihot esculentum L.) Molekul DNA dalam suatu sel dapat diekstraksi atau diisolasi untuk berbagai macam

Lebih terperinci

PENERAPAN METODE POLYMERASE CHAIN REACTION MENGGUNAKAN PRIMER 16E1 DAN 16E2 UNTUK. MENDETEKSI Escherichia coli DALAM BERBAGAI SAMPEL AIR

PENERAPAN METODE POLYMERASE CHAIN REACTION MENGGUNAKAN PRIMER 16E1 DAN 16E2 UNTUK. MENDETEKSI Escherichia coli DALAM BERBAGAI SAMPEL AIR PENERAPAN METODE POLYMERASE CHAIN REACTION MENGGUNAKAN PRIMER 16E1 DAN 16E2 UNTUK MENDETEKSI Escherichia coli DALAM BERBAGAI SAMPEL AIR ANGLIA PUSPANINGRUM 0304050082 UNIVERSITAS INDONESIA FAKULTAS MATEMATIKA

Lebih terperinci

BAB 4 HASIL PERCOBAAN DAN PEMBAHASAN

BAB 4 HASIL PERCOBAAN DAN PEMBAHASAN BAB 4 HASIL PERCOBAAN DAN PEMBAHASAN Sebelum melakukan PCR, terlebih dahulu dilakukan perancangan primer menggunakan program DNA Star. Pemilihan primer dilakukan dengan mempertimbangkan parameter spesifisitas,

Lebih terperinci

OPTIMASI PCR : KONSENTRASI PRIMER DAN VOLUME TEMPLAT DNA PADA AMPLIFIKASI mtdna IKAN MEDAKA Oryzias spp. DI DAERAH ALIRAN SUNGAI (DAS) MAROS

OPTIMASI PCR : KONSENTRASI PRIMER DAN VOLUME TEMPLAT DNA PADA AMPLIFIKASI mtdna IKAN MEDAKA Oryzias spp. DI DAERAH ALIRAN SUNGAI (DAS) MAROS OPTIMASI PCR : KONSENTRASI PRIMER DAN VOLUME TEMPLAT DNA PADA AMPLIFIKASI mtdna IKAN MEDAKA Oryzias spp. DI DAERAH ALIRAN SUNGAI (DAS) MAROS Aqzayunarsih 1) Irma Andriani 2) Rosana Agus 2) Onny Nurrahman

Lebih terperinci

1. Kualitas DNA total Udang Jari (Metapenaeus elegans De Man, 1907) Hasil. Tangkapan dari Laguna Segara Anakan, Cilacap, Jawa Tengah dengan

1. Kualitas DNA total Udang Jari (Metapenaeus elegans De Man, 1907) Hasil. Tangkapan dari Laguna Segara Anakan, Cilacap, Jawa Tengah dengan Lampiran 1. Data dan analisis karakterisasi genetik Udang Jari (Metapenaeus elegans De Man, 1907) Hasil Tangkapan dari Laguna Segara Anakan, Cilacap, Jawa Tengah. 1. Kualitas DNA total Udang Jari (Metapenaeus

Lebih terperinci

BAB III METODE PENELITIAN. Jenis penelitian yang digunakan adalah penelitian deskriptif.

BAB III METODE PENELITIAN. Jenis penelitian yang digunakan adalah penelitian deskriptif. 24 BAB III METODE PENELITIAN 3.1 Jenis Penelitian Jenis penelitian yang digunakan adalah penelitian deskriptif. 3.2 Objek Penelitian DNA ikan gurame (Osphronemus goramy Lac.) yang resisten dan sensitif

Lebih terperinci

BAB IV HASIL DAN PEMBAHASAN. Pada uji pendahuluan dilakukan isolasi DNA menggunakan CTAB.

BAB IV HASIL DAN PEMBAHASAN. Pada uji pendahuluan dilakukan isolasi DNA menggunakan CTAB. BAB IV HASIL DAN PEMBAHASAN A. HASIL PENELITIAN Pada uji pendahuluan dilakukan isolasi DNA menggunakan CTAB. Isolasi DNA dari kultur murni Escherichia coli ATCC 25922 menggunakan CTAB memastikan bahwa

Lebih terperinci

LAMPIRAN. Lampiran 1. Pembuatan Larutan Stok dan Buffer

LAMPIRAN. Lampiran 1. Pembuatan Larutan Stok dan Buffer LAMPIRAN Lampiran 1. Pembuatan Larutan Stok dan Buffer A. LARUTAN STOK CTAB 5 % (100 ml) - Ditimbang NaCl sebanyak 2.0 gram - Ditimbang CTAB sebanyak 5.0 gram. - Dimasukkan bahan kimia ke dalam erlenmeyer

Lebih terperinci

4 HASIL DAN PEMBAHASAN

4 HASIL DAN PEMBAHASAN 24 4 HASIL DAN PEMBAHASAN 4.1 Isolasi dan Purifikasi Bakteri Isolasi merupakan proses pemindahan organisme dari habitat asli ke dalam suatu habitat baru untuk dapat dikembangbiakkan. Purifikasi merupakan

Lebih terperinci

METODOLOGI PENELITIAN

METODOLOGI PENELITIAN II. METODOLOGI PENELITIAN A. Tempat dan Waktu Penelitian Penelitian ini dilaksanakan di Pusat Riset Obat dan Makanan Badan POM RI pada bulan April 2011 hingga Juli 2011. B. Bahan Bahan-bahan yang digunakan

Lebih terperinci

ABSTRAK. OPTIMASI AMPLIFIKASI DAN KLONING GEN Chaperonin 60.1 PADA Mycobacterium tuberculosis

ABSTRAK. OPTIMASI AMPLIFIKASI DAN KLONING GEN Chaperonin 60.1 PADA Mycobacterium tuberculosis ABSTRAK OPTIMASI AMPLIFIKASI DAN KLONING GEN Chaperonin 60.1 PADA Mycobacterium tuberculosis Nia Oktriviany, 2009 Pembimbing I : Ernawati Arifin Giri Rachman, Ph.D Pembimbing serta I : Debbie Sofie Retnoningrum,

Lebih terperinci

BAB III METODOLOGI PENELITIAN. Penelitian yang dilakukan termasuk ke dalam penelitian dasar dimana adanya

BAB III METODOLOGI PENELITIAN. Penelitian yang dilakukan termasuk ke dalam penelitian dasar dimana adanya BAB III METODOLOGI PENELITIAN A. Jenis Penelitian Penelitian yang dilakukan termasuk ke dalam penelitian dasar dimana adanya keingintahuan peneliti terhadap hasil suatu aktivitas. Metode penelitian ini

Lebih terperinci

BAB II TINJAUAN PUSTAKA. bagi sel tersebut. Disebut sebagai penghasil energi bagi sel karena dalam

BAB II TINJAUAN PUSTAKA. bagi sel tersebut. Disebut sebagai penghasil energi bagi sel karena dalam BAB II TINJAUAN PUSTAKA 2.1. Mitokondria Mitokondria merupakan salah satu organel yang mempunyai peranan penting dalam sel berkaitan dengan kemampuannya dalam menghasilkan energi bagi sel tersebut. Disebut

Lebih terperinci

BAHAN DAN METODE. ditranskipsi dan produk translasi yang dikode oleh gen (Nasution 1999).

BAHAN DAN METODE. ditranskipsi dan produk translasi yang dikode oleh gen (Nasution 1999). 4 ditranskipsi dan produk translasi yang dikode oleh gen (Nasution 1999). Polymerase Chain Reaction (PCR) PCR merupakan suatu reaksi in vitro untuk menggandakan jumlah molekul DNA pada target tertentu

Lebih terperinci

Gambar 2 Vektor pengklonan pgem T Easy

Gambar 2 Vektor pengklonan pgem T Easy BAHAN DAN METODE Waktu dan Tempat Penelitian ini dilaksanakan dari bulan September 2007 sampai dengan bulan April 2008. Penelitian dilakukan di Laboratorium Biologi Molekuler Seluler Tanaman, dan Laboratorium

Lebih terperinci

METODE PENELITIAN. A. Tempat dan Waktu

METODE PENELITIAN. A. Tempat dan Waktu 10 III. METODE PENELITIAN A. Tempat dan Waktu Penelitian dilaksanakan pada bulan September 2015 sampai Februari 2016. Isolasi dan visualisasi RNA Colletrotichum dilaksanakan di Laboratorium Hama Penyakit

Lebih terperinci

BAHAN DAN METODE. Metode Penelitian

BAHAN DAN METODE. Metode Penelitian BAHAN DAN METODE Tempat dan Waktu Penelitian Survei penyakit mosaik dan koleksi sampel tanaman nilam sakit dilakukan di Kebun Percobaan Balai Tanaman Obat dan Aromatik (BALITTRO) di daerah Gunung Bunder

Lebih terperinci

IDENTIFIKASI ISOLAT BAKTERI DARI PANTAI BANDEALIT JEMBER BERDASARKAN SEKUEN DNA PENGKODE 16S rrna SKRIPSI. Oleh Dina Fitriyah NIM

IDENTIFIKASI ISOLAT BAKTERI DARI PANTAI BANDEALIT JEMBER BERDASARKAN SEKUEN DNA PENGKODE 16S rrna SKRIPSI. Oleh Dina Fitriyah NIM IDENTIFIKASI ISOLAT BAKTERI DARI PANTAI BANDEALIT JEMBER BERDASARKAN SEKUEN DNA PENGKODE 16S rrna SKRIPSI Oleh Dina Fitriyah NIM 061810401071 JURUSAN BIOLOGI FAKULTAS MATEMATIKA DAN ILMU PENGETAHUAN ALAM

Lebih terperinci

Identifikasi Gen Abnormal Oleh : Nella ( )

Identifikasi Gen Abnormal Oleh : Nella ( ) Identifikasi Gen Abnormal Oleh : Nella (10.2011.185) Identifikasi gen abnormal Pemeriksaan kromosom DNA rekombinan PCR Kromosom waldeyer Kromonema : pita spiral yang tampak pada kromatid Kromomer : penebalan

Lebih terperinci

Fakultas Matematika dan Ilmu Pengetahuan Alam Universitas Riau Kampus Bina Widya Pekanbaru, 28293, Indonesia

Fakultas Matematika dan Ilmu Pengetahuan Alam Universitas Riau Kampus Bina Widya Pekanbaru, 28293, Indonesia ELEKTROFORESIS DNA TOTAL DAN AMPLIFIKASI PCR FRAGMEN GEN COX3 PADA IKAN Kryptopterus limpok (Bleeker 1852) DARI TIGA SUNGAI RAWA BANJIRAN PROVINSI RIAU Vella Nurazizah Djalil 1, Roza Elvyra 2, Dewi Indriyani

Lebih terperinci

PRINSIP UMUM DAN PELAKSANAAN POLYMERASE CHAIN REACTION (PCR)

PRINSIP UMUM DAN PELAKSANAAN POLYMERASE CHAIN REACTION (PCR) Unitas, Vol. 9, No. 1, September 2000 - Pebruari 2001, 17-29 PRINSIP UMUM DAN PELAKSANAAN POLYMERASE CHAIN REACTION (PCR) [General Principles and Implementation of Polymerase Chain Reaction] Darmo Handoyo

Lebih terperinci

III. Bahan dan Metode

III. Bahan dan Metode III. Bahan dan Metode A. Bahan Sampel yang digunakan adalah bakteri penghasil biopigmen hasil isolasi dari Acropora nasuta yang diambil dari Taka Cemara Karimunjawa, Jepara, Jawa Tengah. Bahan kimia yang

Lebih terperinci

The Genetic Fingerprint (Sidikjari Genetik)

The Genetic Fingerprint (Sidikjari Genetik) The Genetic Fingerprint (Sidikjari Genetik) Penting: Jangan lupa selalu memberi label pada tabung Eppi dengan hati-hati. Untuk pipet: Pipet 1000 (biru): gunakan tips biru dan hanya untuk memipet 100-1000

Lebih terperinci

K. Ratnayani, Sagung Chandra Yowani, dan Liangky Syane S. Jurusan Kimia FMIPA Universitas Udayana, Bukit Jimbaran ABSTRAK

K. Ratnayani, Sagung Chandra Yowani, dan Liangky Syane S. Jurusan Kimia FMIPA Universitas Udayana, Bukit Jimbaran ABSTRAK AMPLIFIKASI FRAGMEN 0,4 KB DAERAH D-LOOP DNA MITOKONDRIA LIMA INDIVIDU SUKU BALI TANPA HUBUNGAN KEKERABATAN DENGAN METODE POLYMERASE CHAIN REACTION (PCR) K. Ratnayani, Sagung Chandra Yowani, dan Liangky

Lebih terperinci

Penelitian ini dilakukan di laboratorium Mikrobiologi Pangan Universitas Katolik Soegijapranata pada Agustus 2013 hingga Januari 2014.

Penelitian ini dilakukan di laboratorium Mikrobiologi Pangan Universitas Katolik Soegijapranata pada Agustus 2013 hingga Januari 2014. 2. MATERI DAN METODE 2.1. Waktu dan Tempat Penelitian Penelitian ini dilakukan di laboratorium Mikrobiologi Pangan Universitas Katolik Soegijapranata pada Agustus 2013 hingga Januari 2014. 2.2. Materi

Lebih terperinci

Fakultas Biologi Unsoed

Fakultas Biologi Unsoed TEKMK PCR oleh Drs. Agus Hery Susanto, M.S. staf pengajar Pendahuluan Teknik PCR (polymerase chain reaction) digunakan untuk menggandakan fragmen DNA (urutan basa nukleotida) tertentu secara invitro melalui

Lebih terperinci

Teknik Isolasi Bakteri

Teknik Isolasi Bakteri MODUL 3 Teknik Isolasi Bakteri POKOK BAHASAN : 1. Pengenceran Suspensi Bakteri dari Sumber Isolat/Lingkungan 2. Teknik Isolasi Bakteri (Solid and Liquid Medium) TUJUAN PRAKTIKUM : 1. Memahami persiapan

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN 3.1 Waktu dan Tempat Penelitian dilaksanakan selama 2 bulan pada bulan Maret sampai dengan Juni 2013 yang bertempat di Laboraturium Bioteknologi FPIK UNPAD kampus Jatinangor.

Lebih terperinci

Hasil dan Pembahasan

Hasil dan Pembahasan Bab IV Hasil dan Pembahasan Lumbrokinase merupakan enzim fibrinolitik yang berasal dari cacing tanah L. rubellus. Enzim ini dapat digunakan dalam pengobatan penyakit stroke. Penelitian mengenai lumbrokinase,

Lebih terperinci

Deteksi DNA Seara Visual Dengan Teknik Elektroforesis

Deteksi DNA Seara Visual Dengan Teknik Elektroforesis Deteksi DNA Seara Visual Dengan Teknik Elektroforesis Laurencius Sihotang I. Tujuan 1. Mempelajari 2. Mendeteksi DNA yang telah di isolasi dengan teknik spektrofotometrik 2. mengetahui konsentrasi dan

Lebih terperinci

BAB III METODE PENELITIAN. Penelitian ini dilakukan di Laboratorium Mikrobiologi Departemen Biologi

BAB III METODE PENELITIAN. Penelitian ini dilakukan di Laboratorium Mikrobiologi Departemen Biologi BAB III METODE PENELITIAN 3.1 Waktu dan Lokasi Penelitian Penelitian ini dilakukan di Laboratorium Mikrobiologi Departemen Biologi Fakultas Sains dan Teknologi Universitas Airlangga pada bulan Januari-Mei

Lebih terperinci

IDENTIFIKASI DAGING TIKUS PADA PRODUK ASAL HEWAN DENGAN MENGGUNAKAN TEHNIK POLIMERASE CHAIN REACTION (PCR)

IDENTIFIKASI DAGING TIKUS PADA PRODUK ASAL HEWAN DENGAN MENGGUNAKAN TEHNIK POLIMERASE CHAIN REACTION (PCR) IDENTIFIKASI DAGING TIKUS PADA PRODUK ASAL HEWAN DENGAN MENGGUNAKAN TEHNIK POLIMERASE CHAIN REACTION (PCR) Srihanto, E.A, Setiaji, G, Rumpaka, R dan Firwantoni Balai Veteriner Lampung Jalan Untung Suropati

Lebih terperinci

BAB II TINJAUAN PUSTAKA. Tubuh manusia tersusun atas sel yang membentuk jaringan, organ, hingga

BAB II TINJAUAN PUSTAKA. Tubuh manusia tersusun atas sel yang membentuk jaringan, organ, hingga 6 BAB II TINJAUAN PUSTAKA 2.1 DNA Mitokondria Tubuh manusia tersusun atas sel yang membentuk jaringan, organ, hingga sistem organ. Dalam sel mengandung materi genetik yang terdiri dari DNA dan RNA. Molekul

Lebih terperinci

BAB III METODE PENELITIAN. Metode yang digunakan dalam penelitian ini adalah deskriptif yang

BAB III METODE PENELITIAN. Metode yang digunakan dalam penelitian ini adalah deskriptif yang BAB III METODE PENELITIAN 3.1 Rancangan Penelitian Metode yang digunakan dalam penelitian ini adalah deskriptif yang bertujuan untuk mengetahui variasi genetik (polimorfisme) gen Apo E pada pasien IMA

Lebih terperinci

AMPLIFIKASI GEN CYTOCHROME OXIDASE SUBUNIT I (COI) DARI SAMPEL SIRIP IKAN HIU DENGAN MENGGUNAKAN BEBERAPA PASANGAN PRIMER

AMPLIFIKASI GEN CYTOCHROME OXIDASE SUBUNIT I (COI) DARI SAMPEL SIRIP IKAN HIU DENGAN MENGGUNAKAN BEBERAPA PASANGAN PRIMER AMPLIFIKASI GEN CYTOCHROME OXIDASE SUBUNIT I (COI) DARI SAMPEL SIRIP IKAN HIU DENGAN MENGGUNAKAN BEBERAPA PASANGAN PRIMER (Amplification of Cytochrome Oxidase Subunit I (COI) Gene from Shark Fin Samples

Lebih terperinci

YOHANES NOVI KURNIAWAN KONSTRUKSI DAERAH PENGKODE INTERFERON ALFA-2B (IFNα2B) DAN KLONINGNYA PADA Escherichia coli JM109

YOHANES NOVI KURNIAWAN KONSTRUKSI DAERAH PENGKODE INTERFERON ALFA-2B (IFNα2B) DAN KLONINGNYA PADA Escherichia coli JM109 YOHANES NOVI KURNIAWAN 10702026 KONSTRUKSI DAERAH PENGKODE INTERFERON ALFA-2B (IFNα2B) DAN KLONINGNYA PADA Escherichia coli JM109 Program Studi Sains dan Teknologi Farmasi INSTITUT TEKNOLOGI BANDUNG 2007

Lebih terperinci

BAB IV. HASIL DAN PEMBAHASAN

BAB IV. HASIL DAN PEMBAHASAN BAB IV. HASIL DAN PEMBAHASAN Pada bab ini akan disajikan hasil dan pembahasan berdasarkan langkah-langkah penelitian yang telah diuraikan dalam bab sebelumnya dalam empat bagian yang meliputi; sampel mtdna,

Lebih terperinci

BAB 3 PERCOBAAN Mikroba C. violaceum, Bacillus cereus dan E. coli JM 109

BAB 3 PERCOBAAN Mikroba C. violaceum, Bacillus cereus dan E. coli JM 109 9 BAB 3 PERCOBAAN 3.1 Alat, Bahan dan Miroba 3.1.1 Alat Bunsen, inkubator 37 o C, sentrifuga (Mikro 200R Hettich), Eppendorf 100 ul, 500 ul, 1,5 ml, tabung mikrosentrifuga (Eppendorf), neraca timbang (Mettler

Lebih terperinci

AMPLIFIKASI in vitro GEN PENGKODE PEMSILIN V ASILASE dari Bacillus sp. strain BACS

AMPLIFIKASI in vitro GEN PENGKODE PEMSILIN V ASILASE dari Bacillus sp. strain BACS ABSTRAK' AMPLIFIKASI in vitro GEN PENGKODE PEMSILIN V ASILASE dari Bacillus sp. strain BACS Di dalam materi genetik Bacillus sp. strain diketahui - - ' terdapat gen Penisilin V Asilase. Hal ini terbukti

Lebih terperinci

Teknik Isolasi Bakteri

Teknik Isolasi Bakteri MODUL 3 Teknik Isolasi Bakteri POKOK BAHASAN : 1. Pengenceran Suspensi Bakteri dari Sumber Isolat/Lingkungan 2. Teknik Isolasi Bakteri TUJUAN PRAKTIKUM : 1. Memahami persiapan dan pelaksanaan pengenceran

Lebih terperinci

METODE Waktu dan Tempat Materi Sampel DNA Primer

METODE Waktu dan Tempat Materi Sampel DNA Primer METODE Waktu dan Tempat Penelitian ini dilaksanakan mulai bulan September 2010 sampai dengan bulan Pebruari 2011. Penelitian dilakukan di Laboratorium Genetika Molekuler Ternak Bagian Pemuliaan dan Genetika

Lebih terperinci

ANALISIS VARIASI NUKLEOTIDA DAERAH D-LOOP DNA MITOKONDRIA PADA SATU INDIVIDU SUKU BALI NORMAL

ANALISIS VARIASI NUKLEOTIDA DAERAH D-LOOP DNA MITOKONDRIA PADA SATU INDIVIDU SUKU BALI NORMAL ISSN 1907-9850 ANALISIS VARIASI NUKLEOTIDA DAERAH D-LOOP DNA MITOKONDRIA PADA SATU INDIVIDU SUKU BALI NORMAL Ketut Ratnayani, I Nengah Wirajana, dan A. A. I. A. M. Laksmiwati Jurusan Kimia FMIPA Universitas

Lebih terperinci

Laporan Praktikum Isolasi DNA, Teknik PCR dan Elektroforesis Agarose

Laporan Praktikum Isolasi DNA, Teknik PCR dan Elektroforesis Agarose Laporan Praktikum Isolasi DNA, Teknik PCR dan Elektroforesis Agarose Hari / Tanggal Praktikum : Kamis / 1 November dan 22 November 2012 Nama Praktikan : Rica Vera Br. Tarigan dan Jekson Martiar Siahaan

Lebih terperinci

BAB IV HASIL DAN PEMBAHASAN. Penelitian tentang identifikasi gen angiotensin converting enzyme (ACE)

BAB IV HASIL DAN PEMBAHASAN. Penelitian tentang identifikasi gen angiotensin converting enzyme (ACE) BAB IV HASIL DAN PEMBAHASAN Penelitian tentang identifikasi gen angiotensin converting enzyme (ACE) insersi/ delesi (I/D) dilakukan pada 100 pasien hipertensi yang berobat di poli jantung rumah sakit dr.

Lebih terperinci

TINJAUAN PUSTAKA. Taksonomi Escherichia coli adalah sebagai berikut (6):

TINJAUAN PUSTAKA. Taksonomi Escherichia coli adalah sebagai berikut (6): BAB II TINJAUAN PUSTAKA A. Escherichia coli Taksonomi Escherichia coli adalah sebagai berikut (6): Kingdom Divisio Classis Ordo Familia Genus Spesies : Bacteria : Proteobacteria : Gammaproteobacteria :

Lebih terperinci

BAB XIII. SEKUENSING DNA

BAB XIII. SEKUENSING DNA BAB XIII. SEKUENSING DNA Pokok bahasan di dalam Bab XIII ini meliputi prinsip kerja sekuensing DNA, khususnya pada metode Sanger, pangkalan data sekuens DNA, dan proyek-proyek sekuensing genom yang ada

Lebih terperinci

Y ij = µ + B i + ε ij

Y ij = µ + B i + ε ij METODE Lokasi dan Waktu Penelitian ini dilaksanakan dari bulan September 2008 sampai bulan September 2009. Penelitian dilakukan di Laboratorium Mikrobiologi Bagian Teknologi Hasil Ternak Perah dan Laboratorium

Lebih terperinci

OPTIMASI METODE PCR UNTUK DETEKSI Pectobacterium carotovorum, PENYEBAB PENYAKIT BUSUK LUNAK ANGGREK

OPTIMASI METODE PCR UNTUK DETEKSI Pectobacterium carotovorum, PENYEBAB PENYAKIT BUSUK LUNAK ANGGREK Jurnal Perlindungan Tanaman Indonesia, Vol. 17, No. 2, 2011: 54 59 OPTIMASI METODE PCR UNTUK DETEKSI Pectobacterium carotovorum, PENYEBAB PENYAKIT BUSUK LUNAK ANGGREK OPTIMIZATION OF PCR METHOD FOR THE

Lebih terperinci

BAB II TINJAUAN PUSTAKA. Leuconostoc, Oenococcus, Pediococcus, Paralactobacillus, Streptococcus,

BAB II TINJAUAN PUSTAKA. Leuconostoc, Oenococcus, Pediococcus, Paralactobacillus, Streptococcus, BAB II TINJAUAN PUSTAKA 2.1 Bakteri Asam Laktat Bakteri asam laktat terdiri dari 13 genera bakteri gram positif meliputi Carnobacterium, Enterococcus, Lactoccoccus, Lactobacillus, Lactosphaera, Leuconostoc,

Lebih terperinci

(A) 530C-550C; (B) 560C, 570C, 580C, 600C; (C) 590C, 610C, 620C; (D)

(A) 530C-550C; (B) 560C, 570C, 580C, 600C; (C) 590C, 610C, 620C; (D) 2 melawan mikroba. Peran flavonol dalam bidang kesehatan sebagai antiinflamatori, antioksidan, antiproliferatif, menekan fotohemolisis eritrosit manusia, dan mengakhiri reaksi rantai radikal bebas (Albert

Lebih terperinci

MAKALAH PRASIDANG. Nama / NPM

MAKALAH PRASIDANG. Nama / NPM MAKALAH PRASIDANG Judul Pembimbing Nama / NPM : Identifikasi Mutasi pada Daerah DNA Polimerase dan HBsAg Virus Hepatitis B : 1. Sri Agung Fitri Kusuma, M.Si., Apt. 2. Debbie S Retnoningrum, Ph.D. 3. Tina

Lebih terperinci

SEKUENSING 16S rdna ARKAEBAKTERIA HIPERTERMOFILIK ISOLAT TS3 ASAL KAWAH DOMAS TANGKUBAN PERAHU

SEKUENSING 16S rdna ARKAEBAKTERIA HIPERTERMOFILIK ISOLAT TS3 ASAL KAWAH DOMAS TANGKUBAN PERAHU SEKUENSING 16S rdna ARKAEBAKTERIA HIPERTERMOFILIK ISOLAT TS3 ASAL KAWAH DOMAS TANGKUBAN PERAHU SEQUENSING 16 rdna of HYPERTHERMOPHYLIC ARCHAEBACTERIA TS3 ISOLATE from DOMAS CRATER TANGKUBAN PERAHU (D.

Lebih terperinci

ISBN

ISBN PROSIDING SEMIRATA BKS-PTN B MIPA 2012-biologi 647 PROSIDING SEMIRATA BKS-PTN B MIPA 2012-biologi 648 PROSIDING SEMIRATA BKS-PTN B MIPA 2012-biologi 649 PROSIDING SEMIRATA BKS-PTN B MIPA 2012-biologi 650

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN A. Jenis Penelitian Jenis penelitian yang dilakukan adalah penelitian dasar dengan metode deskriptif, yaitu metode penelitian yang dibuat deskripsi, gambaran atau lukisan secara

Lebih terperinci

AKTIVITAS ANTIJAMUR BAKTERI ENDOFIT LAMUN TERHADAP JAMUR PATOGEN

AKTIVITAS ANTIJAMUR BAKTERI ENDOFIT LAMUN TERHADAP JAMUR PATOGEN AKTIVITAS ANTIJAMUR BAKTERI ENDOFIT LAMUN TERHADAP JAMUR PATOGEN Oleh : AISA AZIZA AN NURIAH 26020110120055 Skripsi sebagai Salah Satu Syarat untuk Memperoleh Derajat Sarjana S1 pada Program Studi Ilmu

Lebih terperinci

III. HASIL DAN PEMBAHASAN

III. HASIL DAN PEMBAHASAN III. HASIL DAN PEMBAHASAN 3.1 HASIL 3.1.1 Isolasi Vibrio harveyi Sebanyak delapan isolat terpilih dikulturkan pada media TCBS yaitu V-U5, V-U7, V-U8, V-U9, V-U24, V-U27, V-U41NL, dan V-V44. (a) (b) Gambar

Lebih terperinci

BAB III METODE PENELITIAN. Jenis penelitian ini merupakan jenis penelitian deskriptif untuk karakterisasi

BAB III METODE PENELITIAN. Jenis penelitian ini merupakan jenis penelitian deskriptif untuk karakterisasi 26 BAB III METODE PENELITIAN A. Jenis Penelitian Jenis penelitian ini merupakan jenis penelitian deskriptif untuk karakterisasi gen virulen dan eksperimental pada uji patogenesitas dengan menggunakan LD

Lebih terperinci

HASIL DAN PEMBAHASAN. divisualisasikan padaa gel agarose seperti terlihat pada Gambar 4.1. Ukuran pita

HASIL DAN PEMBAHASAN. divisualisasikan padaa gel agarose seperti terlihat pada Gambar 4.1. Ukuran pita IV. HASIL DAN PEMBAHASAN 4.1. Amplifikasi Gen Mx Amplifikasi gen Mx telah berhasil dilakukan. Hasil amplifikasi gen Mx divisualisasikan padaa gel agarose seperti terlihat pada Gambar 4.1. Ukuran pita yang

Lebih terperinci

LAPORAN PRAKTIKUM ISOLASI DNA, TEKNIK PCR, DAN ELEKTROFORESIS AGAROSE NAMA PRAKTIKAN : KARIN TIKA FITRIA ( )

LAPORAN PRAKTIKUM ISOLASI DNA, TEKNIK PCR, DAN ELEKTROFORESIS AGAROSE NAMA PRAKTIKAN : KARIN TIKA FITRIA ( ) LAPORAN PRAKTIKUM ISOLASI DNA, TEKNIK PCR, DAN ELEKTROFORESIS AGAROSE NAMA PRAKTIKAN : KARIN TIKA FITRIA (157008003) HARI/ TANGGAL PRAKTIKUM : RAHMIWITA (157008005) 1. ISOLASI DNA DARI DARAH : KAMIS/ 28

Lebih terperinci

I. PENGENALAN NATIONAL CENTRE FOR BIOTECHNOLOGY INFORMATION (NCBI)

I. PENGENALAN NATIONAL CENTRE FOR BIOTECHNOLOGY INFORMATION (NCBI) I. PENGENALAN NATIONAL CENTRE FOR BIOTECHNOLOGY INFORMATION (NCBI) A. PENDAHULUAN NCBI (National Centre for Biotechnology Information) merupakan suatu institusi yang menyediakan sumber informasi terkait

Lebih terperinci

Laporan Praktikum Isolasi DNA, Teknik PCR dan Elektroforesis Agarose

Laporan Praktikum Isolasi DNA, Teknik PCR dan Elektroforesis Agarose Laporan Praktikum Isolasi DNA, Teknik PCR dan Elektroforesis Agarose Hari / Tanggal Praktikum : Kamis / 28 April - 09 Juni 2016 Nama Praktikan : Binayanti Nainggolan Yuliandriani Wannur Azah Pukul : 10.00

Lebih terperinci

I. PENDAHULUAN. perempuan di dunia dan urutan pertama untuk wanita di negara sedang

I. PENDAHULUAN. perempuan di dunia dan urutan pertama untuk wanita di negara sedang I. PENDAHULUAN Kanker serviks menduduki urutan kedua dari penyakit kanker yang menyerang perempuan di dunia dan urutan pertama untuk wanita di negara sedang berkembang (Emilia, dkk., 2010). Berdasarkan

Lebih terperinci

BAB II TINJAUAN PUSTAKA. Madu merupakan produk alam yang dihasilkan oleh lebah dan dapat

BAB II TINJAUAN PUSTAKA. Madu merupakan produk alam yang dihasilkan oleh lebah dan dapat BAB II TINJAUAN PUSTAKA 2.1 Madu Madu merupakan produk alam yang dihasilkan oleh lebah dan dapat dikonsumsi karena mengandung bahan gizi yang sangat essensial. Madu bukan hanya merupakan bahan pemanis,

Lebih terperinci