MOLECULAR IDENTIFICATION BY USING POLYMERASE CHAIN REACTION (PCR) AND DNA SEQUENCING OF DIARRHEA BACTERIA PATHOGENS

Ukuran: px
Mulai penontonan dengan halaman:

Download "MOLECULAR IDENTIFICATION BY USING POLYMERASE CHAIN REACTION (PCR) AND DNA SEQUENCING OF DIARRHEA BACTERIA PATHOGENS"

Transkripsi

1 MOLECULAR IDENTIFICATION BY USING POLYMERASE CHAIN REACTION (PCR) AND DNA SEQUENCING OF DIARRHEA BACTERIA PATHOGENS IDENTIFIKASI MOLEKULAR DENGAN TEKNIK POLYMERASE CHAIN REACTION (PCR) DAN SEKUENSING DNA TERHADAP BAKTERI PATOGEN PENYEBAB DIARE Ety Supriyaningsih, Priyo Wahyudi, Supandi Fakultas Farmasi dan Sains Universitas Muhammadiyah Prof. Dr. Hamka Abstract Diarrhea caused by bacterial infections. Identification of pathogenic bacteria can be done by using molecular techniques. This research aims at detecting bacterial pathogens that cause diarrhea by the method of polymerase chain reaction (PCR ), using 16S rrna gene sequence analysis. Samples were extracted using the GeneJET Genomic DNA Purification Kit, then amplified by PCR using primers 63F and 1387r. Positive PCR results are indicated by the presence of DNA fragments in the electrophoresis gel in the area about 2500 base pairs. This result was followed by sequencing and alignment of data on Basic Local Alignment Search Tool (BLAST). BLAST alignment results Siloam Karawaci Hospitals with samples were known to have 99 % similarity with Escherichia coli O157 H:7. E. coli is a bacterium that is commonly found in patients with diarrhea. Keyword: PCR, DNA sequencing, 16S rrna gene Abstrak Diare dapat disebabkan oleh infeksi bakteri. Identifikasi bakteri patogen dapat dilakukan dengan menggunakan teknik molekuler. Penelitian ini dilakukan untuk mendeteksi bakteri patogen penyebab diare dengan metode polymerase chain reaction (PCR), menggunakan analisa sekuens gen 16S rrna. Sampel diekstraksi menggunakan GeneJET Genomic DNA Purification Kit, kemudian diamplifikasi dengan PCR menggunakan primer 63f dan 1387r. Hasil PCR positif ditunjukkan dengan adanya fragmen DNA pada gel elektroforesis pada daerah sekitar 2500 pasang basa. Hasil ini dilanjutkan dengan sekuensing dan penyejajaran data pada Basic Local Alignment Search Tool (BLAST). Penyejajaran menggunakan BLAST dari sampel yang diperoleh dari Rumah Sakit Siloam Karawaci Tanggerang-Banten diketahui memiliki 99% kemiripan dengan Escherichia coli O157 H:7. Bakteri E. coli merupakan bakteri yang sering terdapat pada penderita diare. Kata kunci: PCR, sekuensing DNA, Gen 16S rrna 1

2 PENDAHULUAN Diare merupakan penyakit disebabkan oleh infeksi bakteri. Bakteri-bakteri penyebab diare merupakan jenis bakteri Gram negatif diantaranya Campylobacter jejuni, Staphylococcus aureus, Bacillus cereus, Clostridium perfringen, Escherichia coli, Clostridium difficile, dan Vibrio cholera (Guerrant et al. 2001). Polymerase Chain Reaction (PCR) adalah salah satu teknik yang dapat melipatgandakan DNA secara in vitro dalam waktu singkat (Yuwono 2006). Proses PCR menggunakan sepasang primer, yang merupakan oligonukleotida yang berperan sebagai amplifikasi molekul DNA, kemudian dielektroforesis dan diidentifikasi menggunakan suatu gen penanda yaitu gen 16S rrna (Aris 2013). Gen 16S rrna merupakan gen yang bersifat spesifik terhadap spesies prokariot sehingga gen 16S rrna dapat digunakan untuk mempelajari hubungan filogenetik dari suatu spesies bakteri (Claridge 2004). Analisa sekuen akan menemukan secara jelas bahwa bakteri patogen tersebut bersifat spesifik terhadap bakteri-bakteri yang menyebabkan penyakit diare (Radji 2010). Analisis sekuen merupakan suatu teknik yang dianggap paling baik untuk melihat keanekaragaman hayati suatu kelompok organisme. Sekuensing DNA adalah suatu proses penentuan urutan basa suatu DNA. Proses ini menggunakan prinsip reaksi polimerisasi DNA secara enzimatis dengan penambahan suatu ddntp. Penyakit infeksi diare menjadi perhatian di Rumah Sakit Siloam Karawaci Tangerang, karena banyaknya jumlah pasien infeksi diare yang disebabkan oleh bakteri. Pada penelitian ini dilakukan identifikasi molekuler terhadap isolat bakteri patogen diare yang diperoleh dari pasien infeksi diare. Isolat bakteri yang didapat dari Rumah Sakit Siloam Karawaci Tanggerang Banten akan diamplifikasi dengan teknik PCR, selanjutnya dilakukan sekuensing terhadap gen 16S rrna. Sekuens yang didapat akan dilakukan penyejajaran menggunakan situs online NCBI atau EMBL. METODOLOGI Alat Penelitian Alat-alat yang digunakan adalah tabung reaksi, micropipet, tube sentrifius 2 ml, jarum ose, batang pengaduk, inkubator, autoklaf, laminar air flow, waterbath, microsentrifuge refrigenerator (Bio-Lion XC-HR 20), peltier thermo cycler (Tanach RAY MG48), elektroforesis (Mupid EXU), UV transiluminator (Extra Gene).. Bahan Penelitian 1. Bahan Isolasi DNA Genom Isolat bakteri diperoleh dari RS Siloam Tanggerang, ethanol 50%, 70%, 96% dan GeneJET Genomic DNA Purification Kit (Thermo Scientific), yang terdiri dari: lysis solution, digestion solution, proteinase K, RNAse solution, wash buffer I, wash bufer II, dan Elution bufer. 2. Bahan Kimia untuk PCR Forward primer (Genetika Science) 63f (5 -CAG GCC TAA CAC ATG CAA GTC-3 ) dan reverse primer (Genetika Science) 1387r (5 -GGG CGG WGT GTA CAA GGC-3) (Marchesi et al. 1998). Deionized demineralized water (Thermo 2

3 Scientific), PCR Master Mix 2x (Thermo Scientific), yang terdiri dari: Taq polimerase, PCR bufer, datp, dgtp, dttp, dctp, dan Mg Bahan Kimia untuk Elektroforesis Gel agarosa, loading dye (Thermo Scientific), etidium bromida, bufer Tris Borat EDTA (TBE) 1x, dan DNA Ladder 1 kb (Thermo Scientific). 4. Bahan untuk Pengkayaan Medium nutrient broth (NB) (Merck). Prosedur Kerja 1. Isolasi DNA Genom dengan GeneJET Kit Tahap awal yang dilakukan dalam penelitian meliputi persiapan alat dan bahan yang digunakan dalam penelitian. Alat-alat seperti tip dan tube sentrifius disterilkan terlebih dahulu dengan autoklaf suhu 121ºC selama 15 menit. Medium NB yang digunakan disterilisasi dengan autoklaf suhu 121ºC selama 15 menit, sedangkan sterilisasi dengan ethanol 70% digunakan untuk sterilisasi laminar air flow dan lingkungan di sekitar perlakuan, sterilisasi dengan pemanasan menggunakan Bunsen digunakan untuk jarum ose.isolat bakteri yang akan digunakan untuk proses isolasi, terlebih dahulu dikultur dalam medium nutrient broth dan diinkubasi jam pada suhu 37 o C. Proses isolasi dilakukan berdasarkan protokol yang terdapat pada GeneJET Genomic DNA Purification Kit. Sebanyak 1,5-2,0 ml kultur bakteri dipindahkan ke dalam tabung mikrosentrifus steril, kemudian disentrifugasi pada kecepatan 5000 x g selama 10 menit. Supernatan yang terbentuk dibuang dan jangan sampai ada sisa medium dalam tabung. Endapan sel bakteri kemudian ditambahkan dengan 20 μl Proteinase K dan 180 μl digestion solution dihomogenkan, lalu diinkubasi 30 menit pada suhu 56 o C sambil sesekali dihomogenkan. Tahap selanjutnya ditambahkan 20 μl RNAse solution lalu dihomogenkan dan diinkubasi suhu ruang selama 10 menit agar sel lisis dengan sempurna. Ditambahkan 200 μl lysis solution, dihomogenkan selama 15 detik lalu ditambahkan dengan 400 μl ethanol 50%, dihomogenkan kembali. Campuran tersebut dipindahkan ke kolom GeneJET Genomic DNA Purification yang dilengkapi dengan collection tube. Kolom disentrifugasi pada kecepatan 6000 x g selama 1 menit. Kemudian kolom GeneJET Genomic DNA Purification dipindahkan ke collection tube 2 ml baru. Pada kolom ditambahkan 500 μl wash bufer I yang telah ditambah dengan ethanol 96%, kemudian disentrifugasi pada kecepatan 8000 x g selama 1 menit. Collection tube dibuang lalu diganti dengan yang baru. Ditambahkan 500 μl wash bufer II yang sudah ditambahkan ethanol 96%, lalu disentrifugasi dengan kecepatan x g selama 3 menit. Jika terlihat larutan belum homogen, maka larutan dihomogenkan kembali selama 1 menit dengan kecepatan maksimum. Diambil larutan bagian bawah tube lalu pindahkan ke kolom GeneJET Genomic DNA Purification 1,5 ml steril. Terakhir, ditambahkan 200 μl elution bufer untuk melarutkan DNA genom. Kemudian diinkubasi selama 2 menit pada suhu ruang, dan disentrifugasi pada kecepatan 8000 x g selama 1 menit. Didapat DNA murni, lalu disimpan pada suhu _ 20 o C. 3

4 Selanjutnya adalah analisis DNA genom bakteri dengan menggunakan Elektroforesis. Untuk membuat agarosa dengan konsentrasi 1,6%, yaitu ditimbang agarosa sebanyak 0,80 g dalam 50 ml air suling steril, dan dididihkan hingga larut. Setelah agak dingin, larutan tersebut dituang pada cetakan gel, sisir dipasang, dan didiamkan hingga gel mengeras. Sisir diangkat dan nampan dipindahkan ke wadah elektroforesis. Wadah tersebut terlebih dahulu diberi bufer TBE 1x hingga menggenangi permukaan gel agarosa. Sebanyak 0,5 μl Loading dye ditambahkan pada 2,5 μl sampel DNA dan dihomogenkan. Campuran tersebut dimasukkan ke dalam cetakan sisir yang tersedia secara hati-hati. Elektroforesis dinyalakan dan tegangan diatur sebesar 100 volt. Kemudian, ditunggu hingga xylene cyanol mencapai 1 cm dari tepi bawah gel. Selanjutnya gel agarosa diambil dan dimasukkan ke dalam wadah yang sudah mengandung etidium bromida selama lima menit dalam ruangan gelap. Hasil diamati pada UV transiluminator pada panjang gelombang 500 nm dan fragmen DNA yang akan muncul didokumentasikan. Hasil positif ditandai dengan adanya fragmen DNA yang muncul pada gel agarosa. 2. Amplifikasi DNA Target dengan PCR Proses amplifikasi genom bakteri terhadap gen 16S rrna menggunakan primer 63f (5 -CAG GCC TAA CAC ATG CAA GTC-3 ) dan pimer 1387r (5 - GGG CGG WGT GTA CAA GGC-3 ) (Marchesi et al. 1998). Proses amplifikasi dilakukan berdasarkan protokol pada PCR Master Mix 2x. Dimasukkan sebanyak 25 μl PCR master mix 2x ke dalam microtube 0,5 ml, kemudian ditambahkan 15 μl deionized demineralized water (ddh2o) dan dihomogenkan. Primer 63f dan 1387r ditambahkan masing-masing sebanyak 2 μl, lalu dihomogenkan. Larutan tersebut dibagi menjadi dua bagian dengan dipipet sebanyak 22 μl dan dimasukkan ke dalam microtube 0,5 ml steril. Sebanyak 3 μl cetakan DNA ditambahkan ke dalam masingmasing microtube untuk memperoleh volume total 25 μl lalu dihomogenkan. Larutan tersebut di spindown dan dimasukkan ke dalam mesin PCR. Kondisi PCR diatur : Denaturasi awal pada suhu 94 o C selama 3 menit sebanyak 1 siklus, denaturasi pada suhu 94 o C selama 1 menit sebanyak 30 siklus, annealing pada suhu 55 o C selama 1 menit sebanyak 30 siklus, ekstensi pada suhu 72 o C selama 5 menit sebanyak 30 siklus dan ekstensi akhir pada suhu 72 o C selama 10 menit sebanyak 1 siklus (Prabu et al. 2010). Hasil amplifikasi dianalisis menggunakan elektroforesis gel agarosa 1,6 %. 3. Sekuensing Gen 16S rrna Amplikon dimasukkan ke dalam microtube 0,5 ml kering dan steril, kemudian diberi label dan disegel dengan parafilm untuk mencegah kebocoran dan perembesan. Sampel dikirim ke 1 st BASE Laboratories, Malaysia untuk selanjutnya dipurifikasi dan disekuensing. 4. Penyejajaran Hasil Sekuen dengan Menggunakan Program Online NCBI dan EMBL Sekuen DNA yang diperoleh dibandingkan dengan sekuen database pada situs EMBL dan NCBI. Lalu dilakukan penyejajaran terhadap persen kemiripannya dengan bakteri lain pada database. Hasilnya dapat dibuat untuk membuat pohon filogenetik. 4

5 Teknik Analisis Data Analisis data hasil deteksi PCR dengan dielektroforesis dan dianalisis berdasarkan ada tidaknya potongan pita DNA yang terbentuk, dan data disajikan secara deskriptif dalam bentuk tabel dan gambar. HASIL DAN PEMBAHASAN A. Isolasi DNA Bakteri Proses isolasi DNA merupakan tahapan awal dari seluruh rangkaian penelitian. Tahap pendahuluan bakteri dikultur dalam medium Nutrient Agar (NA) untuk melihat bentuk koloni bakteri yang terdapat dalam isolat murni. Koloni-koloni yang telah tumbuh selanjutnya dipindahkan dalam medium Nutrient Broth (NB) karena penggunaan medium cair akan memudahkan pada saat proses isolasi. Medium diinkubasi selama jam, menurut Sambrook and Russell (2001) pertumbuhan bakteri mencapai fase log akhir setelah diinkubasi semalam. Fase log akhir merupakan saat yang optimal untuk memanen bakteri, sehingga kuantitas DNA yang diperoleh maksimal. x Gambar 3. Bentuk koloni bulat bakteri Escherichia coli dari pasien Diare RS Siloam Tangerang dalam medium NA. Tanda x (koloni bulat). Setelah proses perbanyakan bakteri. Bakteri-bakteri dilakukan isolasi dan pemurnian DNA dengan menggunakan GeneJET Kit. Kegiatan isolasi DNA ini dilakukan untuk mendapatkan cetakan DNA yang murni dari masing-masing isolat. Proses isolasi DNA dilakukan sesuai dengan protokol yang terdapat pada GeneJET Genomic DNA Purification Kit. 5

6 M EO 1 x Gambar 4. Elektroforegram total genom DNA bakteri EO1 dari pasien diare RS Siloam Karawaci Tangerang Banten. Lajur M (marker), EO1 (DNA bakteri) dan x (pita DNA M EO 3 x Gambar 5. Elektroforegram total genom DNA bakteri EO3 dari pasien diare RS Siloam Karawaci Tangerang Banten. Lajur M (marker), EO3 (DNA bakteri) dan x (pita DNA). Dari kesepuluh isolat yang diperoleh dari rumah sakit, setelah dilakukan isolasi hanya didapatkan dua isolat murni DNA bakteri. Yaitu sampel EO1 dan EO3. Hal ini disebabkan pada saat memvisualisasikan dengan UV Transiluminator, Bentuk DNA yang diperoleh memiliki tingkat kemurnian yang baik pada sampel tersebut dengan ditandai munculnya bentuk pita tunggal atau pita DNA yang tidak berekor. Menurut Herison dkk. (2003) kualitas DNA yang baik yaitu tidak terdapat pola DNA yang terdegradasi pada saat visualisasi gel agarosa, sehingga DNA ini dapat dilanjutkan untuk amplifikasi dengan PCR. B. Amplifikasi Gen 16S rrna Bakteri Amplifikasi DNA dilakukan menggunakan metode PCR dengan primer 63f (5 -CAG GCC TAA CAC ATG CAA GTC-3 ) dan primer 1387r (5 -GGG CGG WGT GTA CAA GGC-3) (Marchesi et al. 1998). 6

7 M EO 3 x Gambar 6. Elektroforegram amplikon Gen 16S rrna bakteri Escherichia coli EO3 dari pasien diare RS Siloam Karawaci Tangerang Banten. Lajur M (marker), EO3 (DNA bakteri) dan x (pita DNA). M EO 1 x Gambar 7. Elektroforegram amplikon Gen 16S rrna bakteri Escherichia coli EO1 dari pasien diare RS Siloam Karawaci Tangerang Banten. Lajur M (marker), EO1 (DNA bakteri) dan x (pita DNA). Proses amplifikasi dimulai dengan denaturasi awal pada suhu 94 o C selama tiga menit, yang bertujuan untuk mempersiapkan untai DNA yang akan didenaturasi. Denaturasi pada suhu 94 o C selama satu menit bertujuan untuk memisahkan untai ganda DNA. Annealing pada suhu 55 o C selama satu menit untuk memberi waktu pada primer untuk menempel pada daerah tertentu dari target DNA. Proses ekstensi pada suhu 72 o C selama lima menit dilakukan dengan tujuan untuk memperpanjang gen 16S rrna. Ekstensi akhir pada suhu 72 o C yang bertujuan untuk menyempurnakan proses penggabungan untai DNA. Proses denaturasi, annealing, dan ekstensi dilakukan sebanyak 30 siklus bertujuan untuk melipatgandakan amplikon, agar saat dilakukan sekuensing jumlah DNA dapat terbaca pada mesin DNA sequencer. 7

8 Visualisasi gambar 7 (EO1) memiliki bentuk smear yang panjang dan terlihat sangat jelas. Hal ini menunjukkan, DNA yang teramplifikasi menunjukkan kualitas DNA kurang baik. Kualitas ini dapat dipengaruhi oleh konsentrasi primer, dntp dan MgCl2 yang digunakan. Menurut Henegariu et al. (1997) konsentrasi primer yang kurang baik dapat menyebabkan primer menempel pada sekuen yang tidak diinginkan dan dapat menyebabkan proses PCR tidak berjalan efisien, sehingga menghasilkan produk yang kurang baik. Pada EO3 muncul pita tunggal, sehingga didapat produk DNA target dengan kualitas baik, sehingga EO3 dapat dilakukan sekuensing DNA dengan mesin DNA sequencer. C. Analisis Hasil Sekuensing Analisis bioinformatika merupakan suatu analisis dengan meng-input data hasil sekuens ( query) pada program resmi di GenBank. Analisis dilakukan dengan menggunakan dua program online yaitu pada situs dan Sebelum dianalisis dengan program tersebut sebaiknya data hasil sekuens dilakukan analisa untuk melihat bentuk puncak atau elektroforegram yang didapat. Gambar 8. Elektroforegram sekuens Gen 16S rrna dari bakteri Escherichia coli pasien diare RS Siloam Karawaci Tangerang Banten menggunakan primer 1387r Gambar 9. Elektroforegram sekuens Gen 16S rrna dari bakteri Escherichia coli pasien diare RS Siloam Karawaci Tangerang Banten menggunakan primer 63f 8

9 Berdasarkan gambar 8 didapat lambang N pada proses pembacaan awal dengan mesin sequencer. Lambang N merupakaan suatu bentuk analisis yang tidak cukup jelas untuk menujukkan keberadaan basa A, C, G, atau T, sehingga harus dihilangkan terlebih dahulu dengan menggunakan program BioEdit. Data yang diperoleh dari program BioEdit berupa data hasil consensus antara primer forward dan primer reverse. Consensus merupakan suatu program yang terdapat pada BioEdit yang digunakan untuk mengontruksi kembali rangkaian urutan DNA yang saling tumpang tindih menjadi bentuk yang tunggal, sehingga dapat dilakukan ke tahap selanjutnya yaitu analisis di GenBank pada program Basic Local Alignment Search Tool (BLAST). Gambar 10. Hasil BLASTN dari sekuens Gen 16S rrna bakteri pasien diare RS Siloam Karawaci Tangerang Banten. Dari hasil BLAST dengan NCBI didapatkan data berupa garis-garis bewarna merah (gambar 10). Hasil ini menunjukkan suatu skala pada tingkat kesamaan sekuens-sekuens yang telah disejajarkan. Hasilnya menunjukkan garis-garis bewarna merah yang berarti kedua sekuens forward maupun reverse pada 16S rrna memiliki tingkat kemiripan yang sangat mirip yaitu lebih dari 200 nukleotida. Warna merah pada hasil menunjukkan bahwa data hasil BLAST valid, karena jika datanya kurang bagus akan ditunjukkan dengan warna biru sampai hitam. 9

10 Gambar 11. Hasil BLASTN dari sekuens Gen 16S rrna bakteri pasien diare RS Siloam Karawaci Tangerang Banten. Gambar 11 merupakan kelanjutan dari hasil BLASTN, dari data tersebut didapatkan bahwa sampel isolat memiliki persen kemiripan 99% pada jenis bakteri Escherichia coli O157:H7 Str Sakai. Nilai E-value yang dihasilkan adalah nol, nilai nol ini menunjukkan sekuens homolog dengan sekuens yang terdapat di GenBank. Hasil ini sesuai dengan penelitian yang dilakukan oleh (Sugianto 2007) yang dilakukan secara mikrobiologi bahwa bakteri utama yang terdapat pada penderita diare adalah jenis bakteri Escherichia coli. Hasil penelitian yang dilakuan secara molekuler maupun penelitian secara mikrobiologi telah didapatkan hasil yang sama, tetapi penelitian secara molekuler memiliki hasil yang lebih jelas karena terlihat sampai pada tingkatan strain bakteri tersebut, sedangkan tidak didapatkan pada penelitian yang dilakukan secara mikrobiologi 10

11 Gambar 12. Hasil BLASTN dari sekuens Gen 16S rrna bakteri pasien diare RS Siloam Karawaci Tangerang Banten. Dari gambar 12 didapat bahwa terdapat garis-garis penghubung antara sekuens yang di atas dengan sekuens yang di bawah. Garis ini menunjukkan terdapat kesesuaian antara sekuens forward 16S dengan sekuens reverse 16S. Sekuens tersebut memiliki kesamaan 99% dengan bakteri Escherichia coli serta ada bagianbagian yang tak terhubung pada garis, menunjukkan adanya perbedaan dari kedua sekuens tersebut pada saat proses penyejajaran. Data sekuens gen 16S rrna dari sampel isolat kemudian dibandingkan dengan beberapa data sekuen gen 16S rrna dari beberapa spesies E.coli lainnya. Hasil perbandingan sekuen ini kemudian divisualisasikan dalam bentuk pohon filogenetik yang dapat menunjukkan hubungan kekerabatan antara satu galur E.coli dengan galur yang lainnya. Pohon filogenetik membuat percabangan yang berupa akar dan cabang. Akar pohon merupakan titik yang bertindak sebagai nenek moyang, sedangkan cabang merupakan titik yang menjelaskan tentang spesies-spesies yang saling memiliki hubungan kekerabatan. Makin dekat cabang, maka hubungan antar spesies itu semakin dekat (Baldauf 2003). 11

12 Shigella sonnei Ss S ribosomal RNA, complete Escherichia coli O157:H7 str Sakai 16S ribosomal RNA, complete sequence EO 3 Escherichia coli str K-12 MG S ribosomal RNA, complete sequence Shigella dysentriae Sd197 16S ribosomal RNA, complete sequence Shigella dysentriae strain ATCC S ribosomal RNA, complete sequence Gambar 13. Cladogram bakteri Escherichia coli O105 H:7 str sakai pasien diare RS Siloam Karawaci Tangerang Banten. Tanda panah: sampel EO3 Pohon filogenetik selain menunjukkan kekerabatan antar spesies yang diperbandingkan, juga menggambarkan perubahan yang terjadi pada gen penanda untuk masing-masing spesies. Semakin panjang suatu cabang artinya semakin banyak perubahan yang terjadi pada gen penanda selama proses evolusi, akibatnya spesies yang berada pada cabang tersebut dapat dikatakan lebih maju. Cladogram merupakan cara yang dipakai untuk mempresentasikan pohon filogenetik (Baldauf 2003). Dari cladogram diketahui sampel EO3 memiliki hubungan yang dekat dengan spesies Escherichia coli str K-12 MG Dari hasil penyejajaran dengan menggunakan BLAST pada situs NCBI didapat bahwa sampel adalah bakteri jenis Escherichia coli O157: H7. Diketahui bakteri ini yang sering terdapat pada penderita diare. Escherichia coli O157: H7 adalah strain enterohemorrhagic (penyebab diare dan kolitis/pendarahan pada dinding kolon). (Obrig 2010). SIMPULAN Identifikasi bakteri patogen penyebab diare berhasil dilakukan dengan menggunakan teknik PCR. Tahap awal isolasi dengan menggunakan GeneJET Genomic DNA Purification Kit dihasilkan suatu produk DNA yang murni dengan ditunjukkan munculnya pita tunggal pada elektroforesis gel agarosa. Hasil amplifikasi dengan PCR didapatkan ukuran DNA sekitar 2500 pasang basa. Hasil sekuensing dan penyejajaran Gen 16S rrna yang dilakukan dengan program online NCBI dan EMBL menyatakan bahwa sampel memiliki kemiripan 99% dengan bakteri Escherichia coli O157 H:7. Bakteri tersebut diketahui menjadi penyebab utama penyakit diare. 12

13 DAFTAR PUSTAKA Aris M, Sukenda, Harris E, Sukadi MF, Yuhana M Identifikasi Molekuler Bakteri Patogen dan Desain Primer PCR. Jurnal Budidaya Perairan. Vol 1 No 3 Halm Baldauf SL Phylogeny for the faint of heart:a tutorial. Journal of Biology. No.6 Halm Clarridge JE Impact of 16S rrna Gene Sequence Analysis for Identification of Bacteria on Clinical Microbiology and Infectious Diseases. Journal Clinical Microbiology Reviews. Vol 17 Halm Guerrant RL, Van Gilder T, Steiner TS, Thielman NM, Slutsker L, Tauxe RV, Hennessy T, Griffin PM, Dupont H, Sack RB, Tarr P, Neill M, Nachamkin I, Reller LB, Osterholm MT, Bennish ML, Pickering LK Practice Guidlines for the Management of Infectious Diarrhea. Journal Clinical Infectious Deseases. Vol 32 Halm Henegariu O, Heerema NA, Dlouhy SR, Vance GH, Vogh PH Multiplex PCR: Critical Parameters and Step-By-Step Protocol. Biomolecular Techniques. Halm Herison C, Rustikawati, Eliyanti Penentuan Protokol yang Tepat untuk Menyiapkan DNA Genom Cabai (Capsicum sp). Jurnal Akta Agrosia. Vol 6. Halm Marchesi JR, Takuichi S, Weightman AJ, Martin TA, Fry JC, Hiom SJ, Wade WG Design and Evaluation of Useful Bacterium-Specific PCR Primers That Amplify Genes Coding for Bacterial 16S rrna. Journal Applied and Environmental Microbiology.Vol 64 Halm Prabhu V, Isloor S, Balu M, Suryanarayana VVS, Rathnamma D Genotyping by ERIC-PCR of Escherichia coli Isolated from Bovine Mastitis Cases. Journal of Biotechnology. Vol 9 Halm Radji M, Puspaningrum A, Sumiati A Deteksi Cepat Bakteri Escherichia coli dalam Sampel Air dengan Metode Polymerase Chain Reaction Menggunakan Primer 16E1 Dan 16E2. Makara Vol 14 Halm Sambrook J, Russell DW Molecular cloning a laboratory Manual. Cold Spring Harbor Laboratory Press. New York. Sugianto E Etiologi Diare Akut Infektif Di Puskesmas Mranggen dan Karangawen Kabupaten Demak. Bagian penyakit Dalam fakultas kedokteran UNDIP RSUP Dr. Kariadi Semarang. Obrig TG Escherichia coli Shiga Toxin Mechanisms of Action in Renal Disease. Journal Toxins Department of Microbiology and Immunology. Halm Yuwono T Teori Dan Aplikasi Polymerase Chain Reaction. Andy Publisher, Yogyakarta. Halm

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN 39 BAB III METODE PENELITIAN A. Desain Penelitian Penelitian yang dilakukan merupakan penelitian deskriptif. Penelitian membuat deskripsi secara sistematis, faktual dan akurat mengenai fakta-fakta dan

Lebih terperinci

MATERI DAN METODE. Kota Padang Sumatera Barat pada bulan Oktober Amplifikasi gen Growth

MATERI DAN METODE. Kota Padang Sumatera Barat pada bulan Oktober Amplifikasi gen Growth III. MATERI DAN METODE 3.1 Waktu dan Tempat Pengambilan sampel darah domba dilakukan di Kecamatan Koto Tengah Kota Padang Sumatera Barat pada bulan Oktober 2012. Amplifikasi gen Growth Hormone menggunakan

Lebih terperinci

BAB III METODE PENELITIAN. Penelitian ini merupakan penelitian yang dilakukan dengan metode

BAB III METODE PENELITIAN. Penelitian ini merupakan penelitian yang dilakukan dengan metode 16 BAB III METODE PENELITIAN A. Jenis Penelitian Penelitian ini merupakan penelitian yang dilakukan dengan metode deskriptif. Penelitian deskriptif adalah suatu metode penelitian untuk membuat deskripsi,

Lebih terperinci

BAB III METODE PENELITIAN. amplifikasi daerah HVI mtdna sampel dengan menggunakan teknik PCR;

BAB III METODE PENELITIAN. amplifikasi daerah HVI mtdna sampel dengan menggunakan teknik PCR; BAB III METODE PENELITIAN Secara garis besar, langkah-langkah yang dilakukan dalam penelitian ini adalah: pengumpulan sampel; lisis terhadap sampel mtdna yang telah diperoleh; amplifikasi daerah HVI mtdna

Lebih terperinci

BAB III. METODOLOGI PENELITIAN. Pengambilan sampel. Penyiapan templat mtdna dengan metode lisis sel

BAB III. METODOLOGI PENELITIAN. Pengambilan sampel. Penyiapan templat mtdna dengan metode lisis sel 16 BAB III. METODOLOGI PENELITIAN Bab ini menggambarkan tahapan penelitian yang terdiri dari pengambilan sampel, penyiapan templat mtdna dengan metode lisis sel, amplifikasi D-loop mtdna dengan teknik

Lebih terperinci

BAB III METODOLOGI PENELITIAN. Penelitian akan diawali dengan preparasi alat dan bahan untuk sampling

BAB III METODOLOGI PENELITIAN. Penelitian akan diawali dengan preparasi alat dan bahan untuk sampling 16 BAB III METODOLOGI PENELITIAN Penelitian akan diawali dengan preparasi alat dan bahan untuk sampling sel folikel akar rambut. Sampel kemudian dilisis, diamplifikasi dan disekuensing dengan metode dideoksi

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN A. Jenis Penelitian Metode penelitian yang digunakan pada penelitian ini adalah deskriptif. Penelitian deskriptif bertujuan untuk membuat deskripsi, gambaran, atau lukisan secara

Lebih terperinci

BAB III METODE PENELITIAN. Dalam penelitian ini dilakukan lima tahap utama yang meliputi tahap

BAB III METODE PENELITIAN. Dalam penelitian ini dilakukan lima tahap utama yang meliputi tahap BAB III METODE PENELITIAN Dalam penelitian ini dilakukan lima tahap utama yang meliputi tahap penyiapan templat mtdna, amplifikasi fragmen mtdna pada daerah D-loop mtdna manusia dengan teknik PCR, deteksi

Lebih terperinci

BAB III METODE PENELITIAN. Secara garis besar langkah-langkah yang dilakukan dalam penelitian ini

BAB III METODE PENELITIAN. Secara garis besar langkah-langkah yang dilakukan dalam penelitian ini BAB III METODE PENELITIAN Secara garis besar langkah-langkah yang dilakukan dalam penelitian ini adalah: pengumpulan sampel; lisis terhadap sampel mtdna yang telah diperoleh; amplifikasi daerah D-loop

Lebih terperinci

BAB 3 METODOLOGI PENELITIAN

BAB 3 METODOLOGI PENELITIAN 20 BAB 3 METODOLOGI PENELITIAN 3.1. Desain Penelitian Penelitian ini bersifat deskriptif cross sectional molekuler. Data yang diperoleh berasal dari pemeriksaan langsung yang dilakukan peneliti sebanyak

Lebih terperinci

BAB III BAHAN DAN METODE

BAB III BAHAN DAN METODE BAB III BAHAN DAN METODE 3.1. Tempat dan Waktu Penelitian 3.1.1. Tempat Penelitian Penelitian dilaksanakan di Laboratorium Bioteknologi Perikanan dan Kelautan Fakultas Perikanan dan Ilmu Kelautan Universitas

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN 3.1 Rancangan Penelitian Penelitian tentang Pengaruh Suhu Annealing pada Program PCR terhadap Keberhasilan Amplifikasi DNA Udang Jari (Metapenaeus elegans) Laguna Segara Anakan

Lebih terperinci

HASIL DAN PEMBAHASAN

HASIL DAN PEMBAHASAN HASIL DAN PEMBAHASAN Amplifikasi ini membutuhkan primer spesifik (sekuen oligonukelotida khusus) untuk daerah tersebut. Primer biasanya terdiri dari 10-20 nukleotida dan dirancang berdasarkan daerah konservatif

Lebih terperinci

BAB III METODE PENELITIAN Bagan Alir Penelitian ini secara umum dapat digambarkan pada skema berikut:

BAB III METODE PENELITIAN Bagan Alir Penelitian ini secara umum dapat digambarkan pada skema berikut: BAB III METODE PENELITIAN Tahapan-tahapan yang dilakukan dalam penelitian ini adalah: pengumpulan sampel, lisis terhadap sampel mtdna yang telah diperoleh, amplifikasi daerah HVI mtdna sampel dengan menggunakan

Lebih terperinci

MATERI DAN METODE. Lokasi dan Waktu. Materi. Tabel 1. Jumah Sampel Darah Ternak Sapi Indonesia Ternak n Asal Sapi Bali 2 4

MATERI DAN METODE. Lokasi dan Waktu. Materi. Tabel 1. Jumah Sampel Darah Ternak Sapi Indonesia Ternak n Asal Sapi Bali 2 4 MATERI DAN METODE Lokasi dan Waktu Penelitian dilaksanakan di Laboratorium Genetika Molekuler Ternak, Bagian Pemuliaan dan Genetika Ternak, Fakultas Peternakan, Institut Pertanian Bogor. penelitian ini

Lebih terperinci

BAB III BAHAN DAN METODE PENELITIAN

BAB III BAHAN DAN METODE PENELITIAN BAB III BAHAN DAN METODE PENELITIAN 3.1 Waktu dan Lokasi Penelitian 3.1.1. Lokasi Penelitian Penelitian ini dilakukan di Laboratorium Bioteknologi Perikanan dan Kelautan Fakultas Perikanan dan Ilmu Kelautan

Lebih terperinci

BAB III METODOLOGI PENELITIAN. Pada penelitian ini terdapat lima tahapan penelitian yang dilakukan yaitu

BAB III METODOLOGI PENELITIAN. Pada penelitian ini terdapat lima tahapan penelitian yang dilakukan yaitu BAB III METODOLOGI PENELITIAN Pada penelitian ini terdapat lima tahapan penelitian yang dilakukan yaitu pengumpulan sampel berupa akar rambut, ekstraksi mtdna melalui proses lisis akar rambut, amplifikasi

Lebih terperinci

FAKULTAS BIOLOGI LABORATORIUM GENETIKA & PEMULIAAN INSTRUKSI KERJA UJI

FAKULTAS BIOLOGI LABORATORIUM GENETIKA & PEMULIAAN INSTRUKSI KERJA UJI Halaman : 1 dari 5 ISOLASI TOTAL DNA HEWAN DENGAN KIT EKSTRAKSI DNA 1. RUANG LINGKUP Metode ini digunakan untuk mengisolasi DNA dari sampel jaringan hewan, dapat dari insang, otot, darah atau jaringan

Lebih terperinci

3 METODOLOGI 3.1 Waktu dan Tempat 3.2 Bahan dan Alat

3 METODOLOGI 3.1 Waktu dan Tempat 3.2 Bahan dan Alat 3 METODOLOGI 3.1 Waktu dan Tempat Penelitian Autentikasi Bahan Baku Ikan Tuna (Thunnus sp.) dalam Rangka Peningkatan Keamanan Pangan dengan Metode Berbasis DNA dilaksanakan pada bulan Januari sampai dengan

Lebih terperinci

BAB III METODE PENELITIAN. Jenis penelitian yang dilakukan termasuk dalam penelitian dasar yang. dilakukan dengan metode deskriptif (Nazir, 1998).

BAB III METODE PENELITIAN. Jenis penelitian yang dilakukan termasuk dalam penelitian dasar yang. dilakukan dengan metode deskriptif (Nazir, 1998). BAB III METODE PENELITIAN A. Jenis Penelitian Jenis penelitian yang dilakukan termasuk dalam penelitian dasar yang dilakukan dengan metode deskriptif (Nazir, 1998). B. Populasi dan Sampel 1. Populasi yang

Lebih terperinci

FAKULTAS BIOLOGI LABORATORIUM GENETIKA & PEMULIAAN INSTRUKSI KERJA UJI

FAKULTAS BIOLOGI LABORATORIUM GENETIKA & PEMULIAAN INSTRUKSI KERJA UJI ISOLASI TOTAL DNA TUMBUHAN DENGAN KIT EKSTRAKSI DNA PHYTOPURE Halaman : 1 dari 5 1. RUANG LINGKUP Metode ini digunakan untuk mengisolasi DNA dari sampel jaringan tumbuhan, dapat dari daun, akar, batang,

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN A. Jenis Penelitian deskriptif. Jenis penelitian yang digunakan adalah penelitian dasar dengan metode B. Objek Penelitian Objek penelitian ini adalah sampel DNA koleksi hasil

Lebih terperinci

3 Metodologi Penelitian

3 Metodologi Penelitian 3 Metodologi Penelitian 3.1 Alat Penelitian ini dilakukan di Laboratorium Penelitian Biokimia, Program Studi Kimia, Institut Teknologi Bandung. Peralatan yang digunakan pada penelitian ini diantaranya

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN 3.1 Waktu dan Tempat Penelitian ini dilaksanakan pada bulan Januari 2012 sampai bulan Juli 2012, yang bertempat di Laboratorium Genetika dan Biologi Molekuler Jurusan Biologi

Lebih terperinci

BAHAN DAN METODE Tempat dan Waktu Penelitian Bahan dan Alat

BAHAN DAN METODE Tempat dan Waktu Penelitian Bahan dan Alat 12 BAHAN DAN METODE Tempat dan Waktu Penelitian Survei penyakit klorosis dan koleksi sampel tanaman tomat sakit dilakukan di sentra produksi tomat di daerah Cianjur, Cipanas, Lembang, dan Garut. Deteksi

Lebih terperinci

VISUALISASI HASIL PCR DENGAN METODE PCR LANGSUNG DAN TIDAK LANGSUNG PADA SAMPEL BAKTERI Pseudomonas fluorescens dan Ralstonia solanacearum

VISUALISASI HASIL PCR DENGAN METODE PCR LANGSUNG DAN TIDAK LANGSUNG PADA SAMPEL BAKTERI Pseudomonas fluorescens dan Ralstonia solanacearum VISUALISASI HASIL PCR DENGAN METODE PCR LANGSUNG DAN TIDAK LANGSUNG PADA SAMPEL BAKTERI Pseudomonas fluorescens dan Ralstonia solanacearum Pendahuluan Polymerase Chain Reaction (PCR) adalah suatu teknik

Lebih terperinci

KATAPENGANTAR. Pekanbaru, Desember2008. Penulis

KATAPENGANTAR. Pekanbaru, Desember2008. Penulis KATAPENGANTAR Fuji syukut ke Hadirat Allah SWT. berkat rahmat dan izin-nya penulis dapat menyelesaikan skripsi yang beijudul "Skrining Bakteri Vibrio sp Penyebab Penyakit Udang Berbasis Teknik Sekuens

Lebih terperinci

OPTIMASI PCR PADA DETEKSI GEN ESTA2-4 DARI ISOLAT KLINIS Escherichia coli DI INSTALASI MIKROBIOLOGI KLINIK RSUP SANGLAH SANGLAH

OPTIMASI PCR PADA DETEKSI GEN ESTA2-4 DARI ISOLAT KLINIS Escherichia coli DI INSTALASI MIKROBIOLOGI KLINIK RSUP SANGLAH SANGLAH OPTIMASI PCR PADA DETEKSI GEN ESTA2-4 DARI ISOLAT KLINIS Escherichia coli DI INSTALASI MIKROBIOLOGI KLINIK RSUP SANGLAH SANGLAH Yosua Hendrata Liman Setiawan Fakultas Kedokteran Universitas Udayana ABSTRAK

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN 25 BAB III METODE PENELITIAN 3.1 Waktu dan Tempat Penelitian telah berlangsung sejak bulan Januari 2012 - Juli 2012 di Laboratorium Mikrobiologi, Lab. Optik, Lab. Genetika dan Lab. Biologi Molekuler Jurusan

Lebih terperinci

BAB III METODE PENELITIAN. Penelitian ini merupakan penelitian eksperimental dengan 7 sampel dari 7

BAB III METODE PENELITIAN. Penelitian ini merupakan penelitian eksperimental dengan 7 sampel dari 7 BAB III METODE PENELITIAN 3.1 Rancangan Penelitian Penelitian ini merupakan penelitian eksperimental dengan 7 sampel dari 7 individu udang Jari yang diambil dari Segara Anakan Kabupaten Cilacap Jawa Tengah.

Lebih terperinci

MATERI DAN METODE. Materi

MATERI DAN METODE. Materi MATERI DAN METODE Lokasi dan Waktu Penelitian dilaksanakan di Laboratorium Genetika Molekuler Ternak, Departemen Ilmu Produksi dan Teknologi Peternakan, Fakultas Peternakan IPB dan Laboratorium Terpadu,

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN A. Jenis Penelitian Jenis penelitian yang digunakan adalah penelitian dasar dengan metode deskriptif (Nazir, 1983). B. Populasi dan Sampel Populasi dalam penelitian ini adalah

Lebih terperinci

BAB XII. REAKSI POLIMERISASI BERANTAI

BAB XII. REAKSI POLIMERISASI BERANTAI BAB XII. REAKSI POLIMERISASI BERANTAI Di dalam Bab XII ini akan dibahas pengertian dan kegunaan teknik Reaksi Polimerisasi Berantai atau Polymerase Chain Reaction (PCR) serta komponen-komponen dan tahapan

Lebih terperinci

4.1. Alat dan Bahan Penelitian a. Alat Penelitian. No. URAIAN ALAT. A. Pengambilan sampel

4.1. Alat dan Bahan Penelitian a. Alat Penelitian. No. URAIAN ALAT. A. Pengambilan sampel 7 IV. METODE PENELITIAN Ikan Lais diperoleh dari hasil penangkapan ikan oleh nelayan dari sungaisungai di Propinsi Riau yaitu S. Kampar dan S. Indragiri. Identifikasi jenis sampel dilakukan dengan menggunakan

Lebih terperinci

4. HASIL DAN PEMBAHASAN

4. HASIL DAN PEMBAHASAN 29 4. HASIL DAN PEMBAHASAN 4.1 Karakteristik isolat bakteri dari ikan tuna dan cakalang 4.1.1 Morfologi isolat bakteri Secara alamiah, mikroba terdapat dalam bentuk campuran dari berbagai jenis. Untuk

Lebih terperinci

3. METODE PENELITIAN

3. METODE PENELITIAN 19 3. METODE PENELITIAN 3.1 Waktu dan Tempat Penelitian ini dilaksanakan pada bulan Maret sampai Juni 2010 di Laboratorium Mikrobiologi, Biokimia dan Bioteknologi Hasil Perairan Departemen Teknologi Hasil

Lebih terperinci

Pengambilan sampel tanah dari lahan tambang timah di Belitung. Isolasi bakteri pengoksidasi besi dan sulfur. Pemurnian isolat bakteri

Pengambilan sampel tanah dari lahan tambang timah di Belitung. Isolasi bakteri pengoksidasi besi dan sulfur. Pemurnian isolat bakteri Lampiran 1. Skema Kerja Penelitian Pengambilan sampel tanah dari lahan tambang timah di Belitung Isolasi bakteri pengoksidasi besi dan sulfur Pemurnian isolat bakteri Karakteriasi isolat bakteri pengoksidasi

Lebih terperinci

bio.unsoed.ac.id METODE PENELITIAN A. Materi, Lokasi, dan Waktu Penelitian 1. Materi Penelitian

bio.unsoed.ac.id METODE PENELITIAN A. Materi, Lokasi, dan Waktu Penelitian 1. Materi Penelitian III. METODE PENELITIAN A. Materi, Lokasi, dan Waktu Penelitian 1. Materi Penelitian 1.1. Peralatan Penelitian Alat yang digunakan dalam penelitian ini adalah botol sampel, beaker glass, cool box, labu

Lebih terperinci

BAHAN DAN METODE Waktu dan Tempat Bahan Metode Isolasi C. gloeosporioides dari Buah Avokad

BAHAN DAN METODE Waktu dan Tempat Bahan Metode Isolasi C. gloeosporioides dari Buah Avokad 15 BAHAN DAN METODE Waktu dan Tempat Penelitian dilaksanakan di Laboratorium Balai Besar Karantina Pertanian (BBKP) Tanjung Priok Wilayah Kerja Bogor, mulai bulan Oktober 2011 sampai Februari 2012. Bahan

Lebih terperinci

III. BAHAN DAN METODE

III. BAHAN DAN METODE 15 III. BAHAN DAN METODE 3.1 Waktu dan Tempat Penelitian Penelitian ini dilaksanakan pada bulan November 2009 hingga Februari 2010. Tempat penelitian adalah di Laboratorium Reproduksi dan Genetika Organisme

Lebih terperinci

Metodologi Penelitian. Metode, bahan dan alat yang digunakan dalam penelitian ini akan dipaparkan pada bab ini.

Metodologi Penelitian. Metode, bahan dan alat yang digunakan dalam penelitian ini akan dipaparkan pada bab ini. Bab III Metodologi Penelitian Metode, bahan dan alat yang digunakan dalam penelitian ini akan dipaparkan pada bab ini. III.1 Rancangan Penelitian Secara garis besar tahapan penelitian dijelaskan pada diagram

Lebih terperinci

MATERI DAN METODE. Materi

MATERI DAN METODE. Materi MATERI DAN METODE Lokasi dan Waktu Penelitian ini dilakukan di Laboratorium Genetika Molekuler Ternak, Bagian Pemuliaan dan Genetik Ternak, Departemen Ilmu Produksi dan Teknologi Peternakan, Fakultas Peternakan,

Lebih terperinci

3. METODE PENELITIAN

3. METODE PENELITIAN 29 3. METODE PENELITIAN 3.1. Lokasi dan Waktu Penelitian Lokasi penelitian meliputi Laut Sulawesi, Selat Makassar, Teluk Bone, Laut Flores, Laut Banda, Teluk Tolo, Laut Maluku dan Teluk Tomini (Gambar

Lebih terperinci

MATERI DAN METODE. Materi. Tabel 1. Sampel Darah Sapi Perah dan Sapi Pedaging yang Digunakan No. Bangsa Sapi Jenis Kelamin

MATERI DAN METODE. Materi. Tabel 1. Sampel Darah Sapi Perah dan Sapi Pedaging yang Digunakan No. Bangsa Sapi Jenis Kelamin MATERI DAN METODE Lokasi dan Waktu Penelitian ini dilaksanakan di Laboratorium Genetika Molekuler Ternak, Bagian Pemuliaan dan Genetika, Fakultas Peternakan, Institut Pertanian Bogor. Penelitian ini berlangsung

Lebih terperinci

HASIL DAN PEMBAHASAN. DNA Genom

HASIL DAN PEMBAHASAN. DNA Genom IV. HASIL DAN PEMBAHASAN A. Isolasi DNA Metode isolasi dilakukan untuk memisahkan DNA dari komponen sel yang lain (Ilhak dan Arslan, 2007). Metode isolasi ini sesuai dengan protokol yang diberikan oleh

Lebih terperinci

II. BAHAN DAN METODE. Betina BEST BB NB RB. Nirwana BN NN RN. Red NIFI BR NR RR

II. BAHAN DAN METODE. Betina BEST BB NB RB. Nirwana BN NN RN. Red NIFI BR NR RR II. BAHAN DAN METODE Ikan Uji Ikan uji yang digunakan adalah ikan nila hibrida hasil persilangan resiprok 3 strain BEST, Nirwana dan Red NIFI koleksi Balai Riset Perikanan Budidaya Air Tawar Sempur, Bogor.

Lebih terperinci

LAMPIRAN. Lampiran 1. Deskripsi Pembuatan Larutan Stok dan Buffer

LAMPIRAN. Lampiran 1. Deskripsi Pembuatan Larutan Stok dan Buffer LAMPIRAN Lampiran 1. Deskripsi Pembuatan Larutan Stok dan Buffer 1. Pembuatan Larutan Stok a. CTAB 5 % Larutan dibuat dengan melarutkan : - NaCl : 2.0 gr - CTAB : 5.0 gr - Aquades : 100 ml b. Tris HCl

Lebih terperinci

III. MATERI DAN METODE A.

III. MATERI DAN METODE A. III. MATERI DAN METODE A. Waktu dan Tempat Penelitian Penelitian ini dilaksanakan pada bulan September sampai dengan Desember 2015. Proses isolasi DNA, simplex-pcr dan duplex-pcr dilaksanakan di Sub Laboratorium

Lebih terperinci

OPTIMASI PCR (Polymerase Chain Reaction) FRAGMEN 724 pb GEN katg MULTI DRUG RESISTANCE TUBERCULOSIS UNTUK MENINGKATKAN PRODUK AMPLIFIKASI

OPTIMASI PCR (Polymerase Chain Reaction) FRAGMEN 724 pb GEN katg MULTI DRUG RESISTANCE TUBERCULOSIS UNTUK MENINGKATKAN PRODUK AMPLIFIKASI OPTIMASI PCR (Polymerase Chain Reaction) FRAGMEN 724 pb GEN katg MULTI DRUG RESISTANCE TUBERCULOSIS UNTUK MENINGKATKAN PRODUK AMPLIFIKASI Deniariasih, N.W. 1, Ratnayani, K. 2, Yowani, S.C. 1 1 Jurusan

Lebih terperinci

4 Hasil dan Pembahasan

4 Hasil dan Pembahasan 4 Hasil dan Pembahasan Dalam bab ini akan dipaparkan hasil dari tahap-tahap penelitian yang telah dilakukan. Melalui tahapan tersebut diperoleh urutan nukleotida sampel yang positif diabetes dan sampel

Lebih terperinci

Teknik-teknik Dasar Bioteknologi

Teknik-teknik Dasar Bioteknologi Teknik-teknik Dasar Bioteknologi Oleh: TIM PENGAMPU Program Studi Agroteknologi Fakultas Pertanian Universitas Jember Tujuan Perkuliahan 1. Mahasiswa mengetahui macam-macam teknik dasar yang digunakan

Lebih terperinci

BAB 3 METODOLOGI PENELITIAN

BAB 3 METODOLOGI PENELITIAN BAB 3 METODOLOGI PENELITIAN 3.1 Desain Penelitian Bentuk desain penelitian yang akan digunakan adalah bentuk deskriptif molekuler potong lintang untuk mengetahui dan membandingkan kekerapan mikrodelesi

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN 3.1 Tempat dan Waktu Penelitian Kegiatan penelitan ini meliputi kegiatan kultivasi kandidat bakteri probiotik dari saluran pencernaan ikan sidat (Anguilla bicolor), uji aktivitas

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN 3.1 Rancangan Penelitian Penelitian tentang Karakterisasi genetik Udang Jari (Metapenaeus elegans De Man, 1907) hasil tangkapan dari Laguna Segara Anakan berdasarkan haplotipe

Lebih terperinci

Tujuan Penelitian. Manfaat Penelitian

Tujuan Penelitian. Manfaat Penelitian 2 mikroorganisme patogen pada bahan pangan dan juga memiliki kemampuan probiotik untuk kesehatan konsumen. Berdasarkan latar belakang tersebut, maka perlu dilakukan seleksi yaitu mencari beberapa isolat

Lebih terperinci

III. METODOLOGI PENELITIAN. Penelitian ini menggunakan metode eksperimental yang bertujuan untuk

III. METODOLOGI PENELITIAN. Penelitian ini menggunakan metode eksperimental yang bertujuan untuk 56 III. METODOLOGI PENELITIAN A. Rancangan Penelitian Penelitian ini menggunakan metode eksperimental yang bertujuan untuk mengamplifikasi Gen FNBP1L. B. Tempat dan Waktu Penelitian 1. Tempat Penelitian

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN A. Jenis Penelitian Penelitian ini merupakan penelitian murni yang dilakukan dengan metode deskriptif, yaitu suatu metode penelitian untuk membuat deskripsi, gambaran atau lukisan

Lebih terperinci

BAB III BAHAN DAN CARA KERJA. Penelitian dilakukan di Laboratorium Institute of Human Virology and

BAB III BAHAN DAN CARA KERJA. Penelitian dilakukan di Laboratorium Institute of Human Virology and 23 BAB III BAHAN DAN CARA KERJA A. LOKASI DAN WAKTU PENELITIAN Penelitian dilakukan di Laboratorium Institute of Human Virology and Cancer Biology of the University of Indonesia (IHVCB-UI), Jl. Salemba

Lebih terperinci

II. METODE PENELITIAN

II. METODE PENELITIAN II. METODE PENELITIAN 1. Materi, Lokasi, dan Waktu Penelitian 1.1. Materi Alat yang digunakan dalam penelitian ini adalah botol sampel, cawan petri, tabung reaksi, labu Erlenmeyer, beaker glass, object

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN A. Jenis Penelitian Jenis penelitian yang dilakukan adalah penelitian deskriptif. Penelitian deskriptif adalah penelitian yang mendeskripsikan suatu gambaran yang sistematis dengan

Lebih terperinci

LAPORAN II (ISOLASI DNA GENOM)

LAPORAN II (ISOLASI DNA GENOM) LAPORAN PRAKTIKUM REKAYASA GENETIKA LAPORAN II (ISOLASI DNA GENOM) KHAIRUL ANAM P051090031/BTK BIOTEKNOLOGI SEKOLAH PASCASARJANA INSTITUT PERTANIAN BOGOR 2010 0 ISOLASI DNA GENOM TUJUAN 16s rrna. Praktikum

Lebih terperinci

MATERI DAN METODE. Lokasi dan Waktu. Materi

MATERI DAN METODE. Lokasi dan Waktu. Materi MATERI DAN METODE Lokasi dan Waktu Penelitian ini dilaksanakan di Laboratorium Genetika Molekuler, Bagian Pemuliaan dan Genetika Ternak, Departemen Ilmu Produksi dan Teknologi Peternakan, Fakultas Peternakan,

Lebih terperinci

BAB III BAHAN DAN METODE

BAB III BAHAN DAN METODE BAB III BAHAN DAN METODE 3.1. Tempat dan Waktu Penelitian 3.1.1. Tempat Penelitian Sampling bakteri kitinolitik dilakukan di beberapa lokasi sekitar Pelabuhan Perikanan Nusantara (PPN) Kejawanan Cirebon.

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN 3.1 Tempat dan Waktu Penelitian Penelitian ini dilakukan di Laboratorium Bioteknologi Perikanan dan Ilmu Kelautan, Fakultas Perikanan dan Ilmu Kelautan (FPIK) Universitas Padjadjaran.

Lebih terperinci

II. MATERI DAN METODE. Tempat pengambilan sampel daun jati (Tectona grandis Linn. f.) dilakukan di

II. MATERI DAN METODE. Tempat pengambilan sampel daun jati (Tectona grandis Linn. f.) dilakukan di II. MATERI DAN METODE 2.1 Waktu dan Tempat Penelitian Tempat pengambilan sampel daun jati (Tectona grandis Linn. f.) dilakukan di enam desa yaitu tiga desa di Kecamatan Grokgak dan tiga desa di Kecamatan

Lebih terperinci

BAB 4. METODE PENELITIAN

BAB 4. METODE PENELITIAN BAB 4. METODE PENELITIAN Penelitian penanda genetik spesifik dilakukan terhadap jenis-jenis ikan endemik sungai paparan banjir Riau yaitu dari Genus Kryptopterus dan Ompok. Penelitian ini bertujuan untuk

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN A. Jenis penelitian Jenis penelitian ini adalah penelitian deskriptif yang mengangkat fenomena alam sebagai salah satu masalah dalam penelitian, sehingga dapat menerangkan arti

Lebih terperinci

FAKULTAS BIOLOGI LABORATORIUM GENETIKA & PEMULIAAN INSTRUKSI KERJA UJI

FAKULTAS BIOLOGI LABORATORIUM GENETIKA & PEMULIAAN INSTRUKSI KERJA UJI Halaman : 1 dari 6 ISOLASITOTAL DNA MANUSIADENGAN KIT EKSTRAKSI DNA 1. RUANG LINGKUP Metode ini digunakan untuk mengisolasi DNA dari sampel jaringan manusia, dapat dari darah, folikel rambut, mukosa mulut

Lebih terperinci

3 METODOLOGI 3.1 Waktu dan Tempat 3.2 Bahan dan Alat

3 METODOLOGI 3.1 Waktu dan Tempat 3.2 Bahan dan Alat 3 METODOLOGI 3.1 Waktu dan Tempat Penelitian dilakukan selama bulan Januari hingga April 2010 bertempat di Laboratorium Karakteristik Bahan Baku, Departemen Teknologi Hasil Perairan, Fakultas Perikanan

Lebih terperinci

Asam Asetat Glacial = 5,7 ml EDTA 0,5 M ph 8.0 = 10 ml Aquades ditambahkan hingga volume larutan 100 ml

Asam Asetat Glacial = 5,7 ml EDTA 0,5 M ph 8.0 = 10 ml Aquades ditambahkan hingga volume larutan 100 ml 36 Lampiran 1. Pembuatan Larutan Stok dan Buffer A. Pembuatan Larutan Stok Tris HCL 1 M ph 8.0 (100 ml) : Timbang Tris sebanyak 12,114 g. Masukkan Tris ke dalam Erlenmeyer dan ditambahkan 80 ml aquades.

Lebih terperinci

METODOLOGI PENELITIAN. Tempat dan Waktu Penelitian. Bahan dan Alat Penelitian

METODOLOGI PENELITIAN. Tempat dan Waktu Penelitian. Bahan dan Alat Penelitian 14 METODOLOGI PENELITIAN Tempat dan Waktu Penelitian Tempat penelitian dilakukan di Laboratorium Unit Pelayanan Mikrobiologi Terpadu, Bagian Mikrobiologi Kesehatan, Departemen Ilmu Penyakit Hewan dan Kesehatan

Lebih terperinci

Saintek Vol 5, No 6, Tahun 2010 POLYMERASE CHAIN REACTION (PCR) Zuhriana K.Yusuf

Saintek Vol 5, No 6, Tahun 2010 POLYMERASE CHAIN REACTION (PCR) Zuhriana K.Yusuf Saintek Vol 5, No 6, Tahun 2010 POLYMERASE CHAIN REACTION (PCR) Zuhriana K.Yusuf Staf Pengajar Jurusan Kesehatan Masyarakat FIKK Universitas Negeri Gorontalo Abstrak (Polymerase Chain Reaction, PCR) adalah

Lebih terperinci

BAB I PENDAHULUAN. Penggunaan mikroorganisme antagonis sebagai agen pengendali hayati

BAB I PENDAHULUAN. Penggunaan mikroorganisme antagonis sebagai agen pengendali hayati BAB I PENDAHULUAN A. Latar Belakang Penggunaan mikroorganisme antagonis sebagai agen pengendali hayati memberikan harapan baru untuk pengendalian hama pertanian terutama fungi yang bersifat patogen. Secara

Lebih terperinci

BAHAN DAN METODE. Analisis Kekerabatan Rayap Tanah M. gilvus dengan Pendekatan Perilaku

BAHAN DAN METODE. Analisis Kekerabatan Rayap Tanah M. gilvus dengan Pendekatan Perilaku BAHAN DAN METODE Tempat dan Waktu Sampel rayap diambil dari Cagar Alam Yanlappa-Jasinga dan Kampus IPB- Dramaga, Bogor. Rayap diidentifikasi dan diuji perilaku agonistiknya di Laboratorium Biosistematika

Lebih terperinci

molekul-molekul agarose. Proses elektroforesis diawali dengan pembuatan gel sebagai medianya yaitu agarose dilarutkan ke dalam TAE 10 X 50 ml yang

molekul-molekul agarose. Proses elektroforesis diawali dengan pembuatan gel sebagai medianya yaitu agarose dilarutkan ke dalam TAE 10 X 50 ml yang Tujuan dari praktikum ini adalah untuk mengisolasi DNA genom yang berasal dari darah sapi segar. Selanjutnya hasil dari isolasi tersebut akan diimplifikasikan dengan teknik in- vitro menggunakan PCR (Polimerase

Lebih terperinci

Identifikasi mikroba secara molekuler dengan metode NCBI (National Center for Biotechnology Information)

Identifikasi mikroba secara molekuler dengan metode NCBI (National Center for Biotechnology Information) Identifikasi mikroba secara molekuler dengan metode NCBI (National Center for Biotechnology Information) Identifikasi bakteri pada saat ini masih dilakukan secara konvensional melalui studi morfologi dan

Lebih terperinci

BAB IV HASIL DAN PEMBAHASAN. A. ISOLASI DNA GENOM PADI (Oryza sativa L.) KULTIVAR ROJOLELE,

BAB IV HASIL DAN PEMBAHASAN. A. ISOLASI DNA GENOM PADI (Oryza sativa L.) KULTIVAR ROJOLELE, BAB IV HASIL DAN PEMBAHASAN A. ISOLASI DNA GENOM PADI (Oryza sativa L.) KULTIVAR ROJOLELE, NIPPONBARE, DAN BATUTEGI Isolasi DNA genom padi dari organ daun padi (Oryza sativa L.) kultivar Rojolele, Nipponbare,

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN A. Jenis Penelitian Jenis penelitian yang dilakukan termasuk penelitian deskriptif. Penelitian deskriptif adalah metode penelitian yang bertujuan membuat gambaran secara sistematis,

Lebih terperinci

PRAKATA. Alhamdulillah syukur senantiasa penulis panjatkan kepada Allah swt., atas

PRAKATA. Alhamdulillah syukur senantiasa penulis panjatkan kepada Allah swt., atas PRAKATA Alhamdulillah syukur senantiasa penulis panjatkan kepada Allah swt., atas segala nikmat dan karunia-nya, penulisan Tugas Akhir dengan judul Keragaman Genetik Abalon (Haliotis asinina) Selat Lombok

Lebih terperinci

HASIL DAN PEMBAHASAN. Uji Kualitatif dan Kuantitatif Hasil Isolasi RNA

HASIL DAN PEMBAHASAN. Uji Kualitatif dan Kuantitatif Hasil Isolasi RNA 6 konsentrasinya. Untuk isolasi kulit buah kakao (outer pod wall dan inner pod wall) metode sama seperti isolasi RNA dari biji kakao. Uji Kualitatif dan Kuantitatif Hasil Isolasi RNA Larutan RNA hasil

Lebih terperinci

BAB III BAHAN DAN METODE

BAB III BAHAN DAN METODE 9 BAB III BAHAN DAN METODE 3.1 Waktu dan Tempat Penelitian Penelitian dilaksanakan pada bulan September 2011 sampai dengan Juli 2012. Kegiatan ekstraksi DNA sampai PCR-RFLP dilakukan di laboratorium Analisis

Lebih terperinci

POLYMERASE CHAIN REACTION (PCR)

POLYMERASE CHAIN REACTION (PCR) POLYMERASE CHAIN REACTION (PCR) Disusun oleh: Hanif Wahyuni (1210411003) Prayoga Wibhawa Nu Tursedhi Dina Putri Salim (1210412032) (1210413031) SEJARAH Teknik ini dirintis oleh Kary Mullis pada tahun 1985

Lebih terperinci

III. BAHAN DAN METODE

III. BAHAN DAN METODE III. BAHAN DAN METODE 3.1. Tempat dan Waktu Penelitian Penelitian dilakukan di Laboratorium Mikrobiologi, Balai Besar Penelitian dan Pengembangan Bioteknologi dan Sumberdaya Genetik Pertanian (BB. Biogen)

Lebih terperinci

III. Bahan dan Metode

III. Bahan dan Metode III. Bahan dan Metode A. Waktu dan Tempat Penelitian Penelitian ini dilaksanakan selama 3 bulan dari bulan Mei-Juli 2011 yang dilakukan di LPPT UGM Yogyakarta. B. Bahan Penelitian Sampel yang digunakan

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN A. Jenis penelitian Jenis penelitian yang dilakukan adalah penelitian dasar dengan metode deskriptif (Nazir, 1988). B. Populasi dan sampel Populasi pada penelitian ini adalah

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN A. Jenis Penelitian Jenis penelitian ini adalah penelitian deskriptif yang mengangkat fenomena alam sebagai salah satu masalah dalam penelitian. Penelitian ini dapat menerangkan

Lebih terperinci

DAFTAR ISI DAFTAR TABEL... DAFTAR GAMBAR... DAFTAR LAMPIRAN...

DAFTAR ISI DAFTAR TABEL... DAFTAR GAMBAR... DAFTAR LAMPIRAN... DAFTAR ISI Bab Halaman DAFTAR TABEL... DAFTAR GAMBAR... DAFTAR LAMPIRAN... ix x xii I II III PENDAHULUAN 1.1 Latar Belakang... 1 1.2 Identifikasi Masalah... 2 1.3 Tujuan Penelitian... 2 1.4 Kegunaan Penelitian...

Lebih terperinci

Gambar 1. Struktur organisasi promoter pada organisme prokariot [Sumber: University of Miami 2008: 1.]

Gambar 1. Struktur organisasi promoter pada organisme prokariot [Sumber: University of Miami 2008: 1.] Gambar 1. Struktur organisasi promoter pada organisme prokariot [Sumber: University of Miami 2008: 1.] Gambar 2. Struktur organisasi promoter pada organisme eukariot [Sumber: Gilbert 1997: 1.] Gambar 3.

Lebih terperinci

MATERI DAN METODE Lokasi dan Waktu Materi Sampel Pengambilan Sampel Ekstraksi DNA Primer

MATERI DAN METODE Lokasi dan Waktu Materi Sampel Pengambilan Sampel Ekstraksi DNA Primer MATERI DAN METODE Lokasi dan Waktu Penelitian ini dilaksanakan pada bulan Juni hingga Nopember 2010. Penelitian dilakukan di Laboratorium Pemuliaan dan Genetik Molekuler, Bagian Pemuliaan dan Genetik Ternak,

Lebih terperinci

ANALISA HASIL TRANSFORMASI DENGAN MENGGUNAKAN PCR KOLONI DAN RESTRIKSI

ANALISA HASIL TRANSFORMASI DENGAN MENGGUNAKAN PCR KOLONI DAN RESTRIKSI 1 ANALISA HASIL TRANSFORMASI DENGAN MENGGUNAKAN PCR KOLONI DAN RESTRIKSI PENDAHULUAN Polimerase Chain Reaction (PCR) PCR adalah suatu reaksi invitro untuk menggandakan jumlah molekul DNA pada target tertentu

Lebih terperinci

LAPORAN PRAKTIKUM REKAYASA GENETIKA

LAPORAN PRAKTIKUM REKAYASA GENETIKA LAPORAN PRAKTIKUM REKAYASA GENETIKA LAPORAN IV (ISOLASI RNA DARI TANAMAN) KHAIRUL ANAM P051090031/BTK BIOTEKNOLOGI SEKOLAH PASCASARJANA INSTITUT PERTANIAN BOGOR 2010 0 ISOLASI RNA DARI TANAMAN TUJUAN Tujuan

Lebih terperinci

Bab III Metode Penelitian

Bab III Metode Penelitian Bab III Metode Penelitian Metode yang dilakukan dalam penelitian ini terdiri dari empat tahapan, dimulai dengan pengumpulan sampel, kemudian lysis sel untuk mendapatkan template DNA, amplifikasi DNA secara

Lebih terperinci

BABm METODE PENELITIAN

BABm METODE PENELITIAN BABm METODE PENELITIAN 3.1 Jenis Penelitian Penelitian ini merupakan penelitian analitik dengan desain cross-sectioned, yaitu untuk mengetahui apakah terdapat perbedaan distnbusi genotipe dan subtipe VHB

Lebih terperinci

MATERI DAN METODE. Lokasi dan Waktu

MATERI DAN METODE. Lokasi dan Waktu MATERI DAN METODE Lokasi dan Waktu Analisis Polymerase Chain Reaction (PCR) serta analisis penciri Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) dilaksanakan di Laboratorium

Lebih terperinci

BAB 4 HASIL PERCOBAAN DAN BAHASAN

BAB 4 HASIL PERCOBAAN DAN BAHASAN 14 BAB 4 HASIL PERCOBAAN DAN BAHASAN Konfirmasi bakteri C. violaceum dan B. cereus dilakukan dengan pewarnaan Gram, identifikasi morfologi sel bakteri, sekuensing PCR 16s rdna dan uji kualitatif aktivitas

Lebih terperinci

BAB III METODOLOGI PENELITIAN. Jenis penelitian yang digunakan adalah penelitian dasar dengan metode

BAB III METODOLOGI PENELITIAN. Jenis penelitian yang digunakan adalah penelitian dasar dengan metode 24 BAB III METODOLOGI PENELITIAN A. Jenis Penelitian Jenis penelitian yang digunakan adalah penelitian dasar dengan metode penelitian deskriptif. B. Objek Penelitian Empat spesies burung anggota Famili

Lebih terperinci

IDENTIFIKASI ISOLAT BAKTERI DARI PANTAI PAPUMA JEMBER BERDASARKAN SEKUEN DNA PENGKODE 16S rrna SKRIPSI. Oleh. Ratno Dwinanto NIM

IDENTIFIKASI ISOLAT BAKTERI DARI PANTAI PAPUMA JEMBER BERDASARKAN SEKUEN DNA PENGKODE 16S rrna SKRIPSI. Oleh. Ratno Dwinanto NIM IDENTIFIKASI ISOLAT BAKTERI DARI PANTAI PAPUMA JEMBER BERDASARKAN SEKUEN DNA PENGKODE 16S rrna SKRIPSI Oleh Ratno Dwinanto NIM 061810401098 JURUSAN BIOLOGI FAKULTAS MATEMATIKA DAN ILMU PENGETAHUAN ALAM

Lebih terperinci

HASIL DAN PEMBAHASAN Isolasi DNA Genomik Sengon

HASIL DAN PEMBAHASAN Isolasi DNA Genomik Sengon HASIL DAN PEMBAHASAN Isolasi DNA Genomik Sengon DNA genomik sengon diisolasi dari daun muda pohon sengon. Hasil uji integritas DNA metode 1, metode 2 dan metode 3 pada gel agarose dapat dilihat pada Gambar

Lebih terperinci

BAB III METODOLOGI PENELITIAN. Jenis penelitian yang digunakan adalah penelitian dasar dengan metode

BAB III METODOLOGI PENELITIAN. Jenis penelitian yang digunakan adalah penelitian dasar dengan metode 22 BAB III METODOLOGI PENELITIAN A. Jenis Penelitian Jenis penelitian yang digunakan adalah penelitian dasar dengan metode penelitian deskriptif. B. Lokasi dan Waktu Penelitian 1. Lokasi Penelitian Penelitian

Lebih terperinci

BAB 3 PERCOBAAN 3.1 Bahan 3.2 Alat

BAB 3 PERCOBAAN 3.1 Bahan 3.2 Alat BAB 3 PERCOBAAN 3.1 Bahan Bahan yang digunakan memiliki kualitas pro analisis atau pro biologi molekular, yaitu : primer M. tuberculosis forward: 5 GGATCCGATGAGCAAGCTGATCGAA3 (Proligo) dan primer M. tuberculosis

Lebih terperinci