BAB IV. Pengembangan Teknologi Akar Rambut Beberapa Tanaman Secara In Vitro ABSTRAK

Save this PDF as:
 WORD  PNG  TXT  JPG

Ukuran: px
Mulai penontonan dengan halaman:

Download "BAB IV. Pengembangan Teknologi Akar Rambut Beberapa Tanaman Secara In Vitro ABSTRAK"

Transkripsi

1 BAB IV Pengembangan Teknologi Akar Rambut Beberapa Tanaman Secara In Vitro ABSTRAK Teknologi akar rambut pada umumnya dimanfaatkan untuk perbanyakan dan perkembangan CMA in vitro, namun di Indonesia belum dilakukan. Penelitian ini bertujuan untuk mendapatkan (1) tanaman yang mampu menginduksi akar rambut, (2) medium terbaik untuk pertumbuhan akar rambut kentang dan wortel, (3) pertumbuhan akar rambut yang mampu tumbuh dengan baik dalam medium kultur ganda, dan (4) konfirmasi hasil T-DNA A. rhizogenes pada akar rambut tanaman uji. Percobaan menggunakan tanaman jagung, sorghum, kentang Granola, kentang Atlantik dan wortel diinfeksi A. rhizogenes galur LBA Eksplan dikulturkan dalam medium MS, B5 dan White tanpa penambahan zat pengatur tumbuh. Kultur diinkubasi dalam ruang gelap. Percobaan menggunakan Rancangan Acak Lengkap Faktorial, dengan ulangan lima kali. Integrasi T-DNA A. rhizogenes dalam akar rambut tanaman uji dianalisis dengan primer spesifik TL dan TR dengan PCR. Hasil yang diperoleh menunjukkan bahwa pertumbuhan akar rambut paling baik tanaman wortel dikulturkan pada medium White, dapat beradaptasi pada medium modifikasi minimal MM. Uji integrasi T-DNA menunjukkan bahwa masing-masing akar rambut teramplifikasi TL dan TR-DNA pada ukuran basa 780 pb TL dan TR 1600 pb. Disimpulkan bahwa akar rambut wortel berpotensi untuk digunakan sebagai inang perbanyakan dan perkembangan CMA G. margarita dan A. tuberculata in vitro Kata kunci : Akar rambut, Agrobacterium rhizogenes, Gigaspora margarita, Acaulospora tuberculata, kultur in vitro, kultur ganda, Daucus carota, Solanum tuberosum, sorghum, Zea mays. The development of hairy root technology of several plants through in vitro culture Abstract Hairy root technology have been used for propagation and development of sterile AMF. However, hairy root technique for mass production of AMF has not developed yet in Indonesia. The objectives of this study are (i) to find the host plant that produce hairy root, (ii) to formulate the appropriate medium for supporting the growth of hairy root of potato and carrot, (iii) to observe the growth of hairy root able to grow well in dual culture, (iv) to confirm the integration of T-DNA of A. rhizogenes LBA 9457 on hairy root tested plants. Plants used in this study are Zea mays, sorghum, Granola potato, Atlantic potato

2 31 and carrot infected by A. rhizogenes strain LBA Explants were cultured on MS, B5, and White medium without the addition of growth hormones, and incubated in dark culture room. Completely Randomized Design were used in these experiments with five replications of each treatment. Hairy root with the best performance were cultured in minimum medium (MM), so that medium MSR for dual culture. The integration of T-DNA of A. rhizogenes on hairy root of tested host plants was analyzed by TL and TR primer by PCR. The result showed that carrot cultured on the White medium gave the best growth of hairy root. Carrot hairy root is the most adaptable on minimum medium (MM). Confirmation test of insertions of A. rhizogenes T-DNA found that there are two bands of DNA with base size of 1600 bp TR and 780 bp TL. It showed that TL and TR DNA from A. rhizogenes have well integrated in hairy root. This research suggested that carrot hairy root can be further developed on AMF host in vitro, especially for G. margarita and A. tuberculata Keys words : Hairy root, Agrobacterium rhizogenes, Gigaspora margarita, Acaulospora tuberculata, dual culture, in vitro- culture, Daucus carota, Solanum tuberosum, sorghum, Zea mays. 1. PENDAHULUAN Akar transforman merupakan salah satu hasil teknologi kultur jaringan, dan hasil induksi T-DNA A. rhizogenes yang dapat mengekspresikan pembentukan akar rambut (Giri & Narasu 2000). Perpindahan T-DNA A. rhizogenes ke dalam sel tanaman, ditandai dengan pembentukan dan pertumbuhan akar rambut yang cepat disebut dengan hairy root (Downs et al. 1994, Frugis et al. 1995), dan ekspresi onkogen plasmid Ri memacu terbentuknya akar adventif (hairy root) pada tempat terinfeksi (Nillson & Olsson 1997). A. rhizogenes merupakan bakteri gram negatif masuk dalam kelompok Rhizobiaceae. Bakteri ini hidup di tanah, bersifat aerobik, tidak membentuk spora, motil dan berbentuk batang. Organisme tersebut mempunyai kemampuan mentransfer sebagian DNA (T-DNA dari plasmid Ri) ke dalam genom tanaman melalui pelukaan (Nillson & Olsson, 1997). T-DNA plasmid Ri terdiri dari dua bagian yaitu daerah TL dan TR. TR-DNA mengandung gen untuk biosintesis auksin dan gen untuk sintesis opin yaitu asam amino derivatif yang tidak ditemukan pada jaringan normal (tanpa inokulasi A. rhizogenes). TL-DNA mengkode satu set gen lokus akar yaitu gen rol A, rol B, dan rol C (Ooms 1992, Frugis et al. 1995).

3 32 Gen tersebut penyandi hormon pertumbuhan auksin dan sitokinin. Apabila onkogen terekspresi maka terjadi pertumbuhan sel yang sangat cepat, sehingga mencirikan pembentukan akar adventif pada tempat yang diinfeksi (Nillson & Olsson 1997). Akar tersebut bersifat otonomi terhadap fitohormon. Gen tersebut selalu ditemukan dalam akar tanaman yang ditransformasi oleh Agrobacterium, sedang TR-DNA yang mengkode biosintesis opin dan auksin tidak selalu ditemukan pada akar transforman (Nasir 2002, Christey & Braun 2004). Christey & Braun (2004) menyatakan bahwa sedikitnya ada tujuh langkah dalam proses transfer molekul T-DNA dari sel Agrobacterium ke sel tanaman, yaitu (1) pengenalan sel tanaman yang rentan (2) induksi ekspresi gen vir, (3) produksi kopy T-DNA yang dapat ditransfer, (4) transfer kompleks T-DNA ke membran bakteri, (5) transfer kompleks T-DNA melalui membran bakteri dan sitoplasma tanaman, (6) transfer kompleks T-DNA melalui sitoplasma tanaman dan membran inti, terakhir integrasi elemen T-DNA kedalam genom inti tanaman. Keberhasilan integrasi T-DNA pada sel tanaman dapat diuji dengan menggunakan teknik Polymerase Chain Reaction (PCR) yaitu suatu teknik sintesis dan amplifikasi DNA secara in vitro (Handoyo & Ruditerna 2000, Bourgaize et al. 2000, Mondal et al. 2001). Toruan-Mathius et al. (2004) melaporkan bahwa tanaman kina C. ledgeriana dan C. succirubra mampu membentuk akar rambut melalui eksplan daun yang dilukai dan diinfeksi dengan A. rhisogenes galur LBA Eksplan yang mampu membentuk akar rambut berkembang baik dalam medium Murashige & Skoog (1962) tanpa penambahan zat pengatur tumbuh. Akar rambut mempunyai keunggulan dalam beberapa karakter penting, seperti morfologi, kapasitas pertumbuhan, dan struktur biokimianya, sehingga banyak digunakan sebagai inang CMA dalam kultur aksenik (Tanaka 1997). Akar rambut banyak digunakan dalam mempelajari proses simbiosis dan perkembangan CMA obligat. Fortin et al. (2002) menyatakan bahwa akar rambut merupakan alat untuk mempelajari tahapan simbiosis CMA. Sejak pertengahan 1980 akar rambut digunakan untuk mempelajari kultur CMA secara in vitro, interaksi CMA dan jasad renik (Filion et al. 1999), di samping itu kultur akar rambut juga digunakan untuk mempelajari penyerapan nutrisi CMA (Jolicoeur et

4 33 al. 2002, Bago et al. 2000, Toussains 2002). Jolicoeur et al. (1999) menyatakan bahwa CMA yang dikembangkan dalam kultur akar rambut in vitro dapat meningkatkan propagul. Pada umumnya penelitian pengembangan CMA secara in vitro menggunakan akar rambut (Becard & Fortin 1988, Nuutile et al. 2001, Khaliq & Bagyaraj 2000). Boisson-Sernier et al. (2001) menyatakan akar rambut Medicago trunculata digunakan untuk mempelajari asosiasi antara CMA dan Rhizobium. Selain itu kultur akar rambut juga dapat diamplifkasi sebagai inang untuk menghasilkan protein asing seperti anti bodi (Wongsamuth & Doran 1997). Giri & Narasu (2000) menyatakan bahwa ada beberapa faktor yang mempengaruhi pertumbuhan dan biomasa kultur akar rambut, antara lain komposisi nutrisi di dalam medium, jenis medium, jenis tanaman dan faktor fisik seperti suhu, dan cahaya. Ernawati (1990) melaporkan bahwa peningkatan konsentrasi sukrosa sampai 6 % dapat meningkatkan produksi senyawa anti jamur pada kultur akar rambut Polygonum tinchorium.ait. Selain itu juga diperoleh media terbaik merangsang pertumbuhan akar rambut P. tinchorium.ait., dengan media dasar MS, demikian juga bobot kering dan antosianin yang dihasilkan. Tidak semua tanaman memberikan respons terhadap T-DNA dari A. rhizogenes, karena proses terakumulasinya T-DNA A. rhizogenes pada tanaman merupakan suatu proses yang sangat kompleks. Banyak faktor yang mempengaruhi, di antaranya eksplan yang akan diinokulasi, jenis tanaman, media dan jenis bakteri yang digunakan, serta lingkungan abiotik dan biotik (Aneloi 2004, Reflini 2002). Tujuan penelitian adalah untuk mendapatkan (i) tanaman inang yang mampu membentuk akar rambut, (ii) medium terbaik untuk pertumbuhan akar rambut kentang dan wortel, (iii) medium kultur ganda terbaik untuk pertumbuhan akar rambut kentang Granola dan wortel, dan (iv) konfirmasi hasil T-DNA A. rhizogenes pada akar rambut tanaman yang diuji.

5 34 2. BAHAN DAN METODE Penelitian dilakukan di Laboratorium Biomolekuler dan Rekayasa Genetik, Balai Penelitian Bioteknologi Perkebunan Indonesia dan Laboratorium Fisiologi Tumbuhan, Jurusan Biologi FMIPA Institut Pertanian Bogor dari bulan Juni 2003 Desember Penelitian terdiri dari beberapa percobaan, yaitu (1) seleksi tanaman inang yang mampu membentuk akar rambut, (2) seleksi media pertumbuhan akar rambut (3) pertumbuhan akar rambut dalam medium modifikasi minimal (kultur ganda), dan (4) uji konfirmasi T-DNA A. rhizogenes 2.1. Seleksi tanaman inang membentuk akar rambut Bahan tanaman yang digunakan adalah jagung, sorghum, kentang Granola, kentang Atlantik dan wortel. Benih jagung, sorghum dan wortel disterilkan dengan alkohol 70 % 3 menit dan Bayclin 30 % (NaOCl 2, 1,56 %), selama 5 menit, kemudian dicuci dengan akuades steril. Benih dikecambahkan di dalam cawan Petri berisi kertas saring steril yang dilembabkan dengan akuades steril, dan digunakan setelah kecambah umur dua minggu. Selanjutnya lima kecambah dari masing-masing tanaman dikulturkan dalam botol berisi medium MS. Kultur diinkubasi dalam ruang bercahaya luks 12 jam/hari, Rh %, dan suhu 26 o C. Untuk bahan tanam kentang Granola dan Atlantik digunakan planlet berumur 1-2 bulan berasal dari Lab. Kultur Jaringan jurusan Agronomi IPB. Secara rutin setiap 1 bulan kultur diremajakan melalui penggandaan tunas aksilar dalam medium MS dengan penambahan 0,1 mg/l kinetin. Sebelum A. rhizogenes galur LBA 9457 diinokulasikan, terlebih dahulu diperbanyak dengan dikulturkan dalam medium suspensi YMB (Lampiran 2) dan dikocok menggunakan mesin pengocok dengan kecepatan 100 rpm (12 jam/hari) (Sambrook et al. 1989). Kultur ditempatkan dalam ruang kultur bercahaya 12 jam /hari, suhu 26 o C Rh %. Kultur berumur 48 jam siap digunakan untuk inokulasi tanaman uji. Inokulasi A. rhizogenes terhadap tanaman uji dilakukan dengan cara melukai jaringan batang tanaman dengan pisau bedah steril, kemudian dipotongpotong sepanjang 2 cm dan dikokultivasi selama 1 jam dalam suspensi bakteri.

6 35 Setelah dikeringkan di atas kertas saring steril, sebanyak tiga potong dari masingmasing tanaman dikulturkan dalam medium Murashige dan Skoog (MS), B5 dan White (Lampiran 1), dengan penambahan 100 mg/l ampisilin. Respons tanaman terhadap A. rhizogenes ditentukan berdasarkan terbentuk tidaknya akar rambut dan waktu inisiasi terbentuknya akar rambut. 2.2.Seleksi media pertumbuhan akar rambut dari tanaman yang merespons A. rhizogenes Akar rambut yang terbentuk pada percobaan (1) dipotong sepanjang 2 cm dan dikulturkan dalam medium yang sama dengan percobaan (1). Akar rambut yang pertumbuhan dan regenerasinya paling baik, tidak terpengaruh dengan subkultur, mempunyai percabangan akar yang banyak, dan mampu beradaptasi pada media modifikasi minimal (MM) (Becard & Fortin 1988) akan digunakan sebagai inang CMA secara in vitro. Peubah yang diamati pada pengaruh medium dan jenis tanaman terhadap pertumbuhan akar rambut adalah berat kering akar rambut pada umur 6 minggu setelah dikulturkan, serta penampakan akar rambut secara visual Pertumbuhan akar rambut dalam medium minimal (kultur ganda) Setelah diperoleh pertumbuhan akar rambut yang terbaik dari percobaan (II), diadaptasikan pada medium modifikasi minimal (MM) (Becard & Fortin 1988). ujung akar rambut dipotong sepanjang 2 cm, sebanyak 3 potong kemudian dikulturkan pada cawan Petri. Pengamatan dilakukan pada umur 0,3 dan 6 minggu setelah kultur, masing-masing pengamatan diulang sebanyak sepuluh kali. Peubah yang diamati adalah berat kering akar rambut dan visual akar. Data yang dikumpul adalah rerata berat kering/mg sampel pada setiap umur pengamatan Uji konfirmasi integrasi T-DNA A. rhizogenes. Uji konfirmasi T-DNA menggunakan analisis PCR, terdiri atas beberapa tahapan, yaitu : 1) isolasi DNA plasmid A rhizogenes, 2) isolasi DNA tanaman yang merespons T-DNA A rhizogenes dan akar rambut. Uji konfirmasi transformasi dengan PCR terdiri atas beberapa tahap yaitu isolasi DNA plasmid A.

7 36 rhizogenes, isolasi DNA tanaman uji in vitro dan DNA akar rambut tanaman uji, penetapan kualitas dan kuantitas DNA dengan elektroforesis, dan uji DNA dengan PCR. Kontrol positif digunakan DNA plasmid A. rhizogenes galur LBA DNA tanaman yang tidak diinokulasi dengan A. rhizogenes digunakan sebagai kontrol negatif, dan DNA uji adalah DNA akar rambut. DNA Plasmid A. rhizogenes diisolasi menggunakan modifikasi metode Sambrook et al. (1989). Sedang isolasi DNA tanaman dan akar rambut kentang Granola, kentang Atlantik dan wortel diisolasi menggunakan modifikasi metode Orozco-Castillo et al. (1994). (Lampiran 3, 4). Untuk deteksi TL-DNA digunakan pasangan primer rol B 1 (5'ATGGATCCAAATTGCTATTCCCCACGA3') dan rol B 2 (5'TTAGGCTTTCATTCGGGTTTACTGCAGC3'). Sedangkan pasangan primer TR1 (5'GGAAATTGTGGCGTTGTTGTGGAC3') dan TR 2 (5'AATCGTTCAGAGAGCGTCCGAAGTT3') digunakan untuk deteksi TR-DNA (Ermayanti et al. 2000). Isolasi DNA Plasmid A. rhizogenes Isolasi DNA plasmid dilakukan dengan modifikasi metode Sambrook et al (1989). Satu mata ose isolat A. rhizogenes galur LBA 9457 murni, dimasukkan ke dalam Erlenmeyer 100 ml yang berisi 50 ml medium YMB (komposisi dalam Lampiran 3) dan diletakkan pada inkubator bergoyang dengan kecepatan 100 rpm selama 48 jam. Kultur dituang ke dalam tabung Eppendorf 2 ml dan disentrifugasi dengan kecepatan rpm selama 2 menit sehingga terbentuk pelet. Pelet dilarutkan dengan 500 µl bufer TE dan 50 µl lisozim 10 mg/ml. Campuran dikocok selama 5 menit dan diinkubasikan pada suhu 37 o C selama 1 jam. Selanjutnya campuran ditempatkan di dalam penangas air selama 1-2 menit, lalu dimasukkan ke dalam air es beberapa saat. Ke dalam campuran ditambahkan 50 µl SDS 10 % dan dikocok perlahanlahan sampai sel-sel lisis dan terlihat berlendir. Campuran lalu disentrifugasi dengan kecepatan 5000 rpm selama 30 menit pada suhu ruang. Supernatan yang terbentuk dipindahkan ke dalam tabung Eppendorf yang baru dan ke dalamnya ditambahkan 2-3 x volume etanol absolut dingin. Untuk memurnikan DNA ke

8 37 dalam campuran ditambahkan 0,1 volume Na-asetat 3 M dan disimpan pada suhu -20 o C selama 30 menit. Selanjutnya campuran disentrifugasi dengan kecepatan rpm selama 2 menit sehingga terbentuk pelet DNA. Pelet DNA dicuci dengan alkohol 70 %, dikeringkan dengan vakum, dilarutkan dengan akuades steril dan ditambah 10 µl RNAase 10 mg/ml. Campuran dihomogenkan, selanjutnya diinkubasi pada 37 o C selama 1 jam. Untuk pemurnian ditambahkan 0,1 x volume Na-asetat dan 2,5 x volume etanol absolut. Campuran dihomogenkan dan disimpan pada -20 o C selama 30 menit, kemudian disentrifugasi dengan kecepatan 8000 rpm selama 5 menit. Selanjutnya supernatan dibuang, dan pelet DNA dicuci dengan alkohol 70 % dikering anginkan. Pelet dilarutkan dengan akuabides steril dan disimpan pada suhu -20 o C. Kemudian pelet dikeringkan dan dilarutkan dalam bufer TE ph 8.0. DNA yang diperoleh digunakan untuk pengujian PCR. Isolasi DNA tanaman dan akar rambut dilakukan dengan menggunakan modifikasi metode Orozco-Castillo et al. (1994) (Lampiran 4). Penetapan Kuantitas dan Kualitas DNA Penetapan kuantitas (konsentrasi) dan kualitas DNA dapat dilakukan dengan cara elektroforesis menurut Sambrook et al. (1989). Uji Kualitas dan kuantitas DNA dilakukan dengan menggunakan larutan DNA contoh sebanyak 2 µl dilarutkan dengan 8 µl akuades steril dan ditambah 2 µl loading buffer, kemudian dikocok perlahan sampai merata. Kuantitas dan kualitas DNA dapat ditentukan dengan cara elektroforesis menggunakan gel agarose 1 % (b/v). Pembuatan gel agarose dilakukan dengan melarutkan 0,4 g agarose ke dalam 30 ml larutan TAE 1x dengan pemanasan dalam microwave selama 1 menit. Larutan agarose diinkubasi pada suhu 65 o C selama 30 menit dan ditambah 1,5 µl etidium bromida. Setelah itu dikocok perlahan hingga larut dan dituang ke dalam cetakan gel. Gel akan memadat setelah 1 jam lalu dimasukkan ke dalam bak elektroforesis. Larutan TAE 1x dimasukkan ke dalam bak elektroforesis sampai seluruh gel terendam. Elektroforesis DNA dilakukan dengan memasukkan 12 µl larutan DNA ke dalam sumur gel. Elekroforesis dijalankan pada tegangan 50 V selama 1,25 jam. Hasil elektroforesis diamati dengan UV transluminator.

9 38 Uji Konfirmasi DNA dengan PCR Amplifikasi DNA dilakukan dengan teknik PCR menggunakan modifikasi metode Aoki et al. (1997). Sebelum melakukan PCR, terlebih dahulu dibuat campuran utama (master mix) (Lampiran 5 b). Masing-masing contoh DNA sebanyak 2 µl (100 ng) di masukkan ke dalam tabung Eppendorf volume 500 µl dan ditambahkan ke dalamnya 23 µl master mix, dan dikocok perlahan-lahan. Untuk mencegah terjadinya penguapan ditambahkan 23 µl minyak mineral. Tabung-tabung tersebut selanjutnya dimasukkan ke dalam blok-blok pada alat Thermal Cycler. Suhu dan lamanya pemanasan dibagi menjadi tiga tahap, yaitu tahap denaturasi pada suhu 94 o C selama 1 menit, tahap annealing pada suhu 55 o C selama 1 menit dan tahap ekstension pada suhu 72 o C selama 2,5 menit. Seluruh reaksi dilakukan sebanyak 35 siklus reaksi. Hasil PCR difraksinasi dengan elektroforesis menggunakan 0,8 % (b/v) gel agarose yang mengandung 2,5 µl etidium bromida 1 % di dalam bak elektroforesis yang berisi 1x bufer TAE dengan kondisi arus 36 ma dan 50 volt selama kurang lebih 1 jam. Sebagai marker digunakan DNA 1 Kb Ladder. DNA hasil elektroforesis divisualisasikan di atas UV transluminator dan untuk dokumentasi dilakukan pemotretan dengan menggunakan film polaroid 665. Pengamatan dilakukan dengan melihat adanya pita DNA dari akar rambut yang mempunyai ukuran molekul yang sama dengan TR dan TL-DNA plasmid A. rhizogenes pada gel elektroforesis hasil PCR. Amplifikasi ditambah 5 µl loading bufer dan difraksinasi menggunakan elek troforesis yang berisi 1 x bufer TAE pada arus 36 ma dan 50 volt selama kurang lebih 1 jam. Standar yang digunakan adalah DNA 1 kb Ladder.

10 39 3. HASIL 3.1. Seleksi tanaman inang membentuk akar rambut Respons kelima jenis eksplan yang digunakan terhadap inokulasi A. rhizogenes, menunjukkan bahwa jagung dan sorghum tidak terjadi induksi, sehingga tidak membentuk akar rambut. Sedang eksplan kentang Granola, kentang Atlantik dan wortel terjadi induksi, sehingga terbentuk akar rambut pada bagian yang dilukai tanpa didahului pembentukan kalus, dan akar rambut tumbuh pada ketiga medium yang digunakan (Tabel 4.1.). Tabel 4.1. Respons eksplan terhadap A. rhizogenes galur LBA 9457, dikulturkan dalam medium MS, B5 dan White Bahan tanam Jenis media MS B5 White Sorghum - *) - - Jagung Kentang Granola Kentang Atlantik Wortel Keterangan *) : - : Tidak terjadi induksi pembentukan akar rambut ; + : Terjadi induksi pembentukan akar rambut Hasil yang diperoleh menunjukkan bahwa kentang Granola, kentang Atlantik dan wortel merespons A. rhizogenes dengan membentuk akar rambut. Pertumbuhan akar rambut paling cepat pada medium MS dibandingkan dengan media lain, yaitu antara 5 7 hari, dan medium lain membutuhkan waktu lebih 7 hari (Tabel 4.2.). Tabel 4.2. Waktu inisiasi pembentukan akar rambut pada eksplan kentang Granola, kentang Atlantik dan wortel pada media MS, B5 dan White. Bahan tanaman Media dasar (hari) MS B5 White Kentang Granola Kentang Atlantik Wortel

11 Seleksi media pertumbuhan akar rambut kentang dan wortel Interaksi jenis medium dan jenis eksplan terhadap berat kering akar rambut terlihat bahwa pertumbuhan paling baik tanaman wortel yang dikultur dalam medium White. Sedang berat kering akar rambut kentang Granola dan kentang Atlantik paling baik pada medium MS (Tabel 4.3., Gambar 4.1. dan 4.2.). Selanjutnya akar rambut kentang Granola dan wortel dilakukan pengujian di dalam kultur ganda (MM). Tabel 4.3. Berat kering akar rambut yang dikulturkan dalam media B5, MS, dan White umur 6 minggu setelah dikulturkan Jenis medium Kentang Granola Kentang Atlantik Wortel mg B5 5,80 e 5,26 f 8,44 d MS 13,94 b 8,86 c 3,40 h White 4,66 g 4,50 g 36,02 a Keterangan*) :Huruf yang sama dalam baris yang sama tidak berbeda nyata berdasarkan uji DMRT(P< 0,05) Diagram pertumbuhan akar rambut (bobot kering) yang dikultur pada medium MS, B5 dan White menunjukkan bahwa akar rambut kentang Granola dan Atlantik tumbuh paling baik pada medium MS. Sedang akar rambut wortel pada medium White. Pertumbuhan ketiga akar rambut paling baik adalah wortel pada medium White (Gambar 4.1.). Bobot kering akar rambut (mg) MS B5 White Jenis medium k. Granola k. Atlantik Wortel Gambar 4.1. Diagram pertumbuhan akar rambut pada media MS, B5 dan White umur 6 minggu setelah kultur.

12 41 Hasil visual pertumbuhan akar rambut menunjukkan bahwa, pertumbuhan akar rambut paling baik adalah wortel yang dikultur pada medium White, apabila dibandingkan dengan perlakuan lain, terlihat pada umur yang sama akar rambut tumbuh memenuhi cawan Petri (Gambar 4.2.). Medium MS Medium B5 Medium White A A A B B B C Gambar 4.2. Pertumbuhan akar rambut pada masing-masing tanaman dan medium umur 6 minggu setelah kultur. A. kentang Granola B. kentang Atlantik; C. Akar rambut wortel (perbesaran 3 x). C 3 cm C 3.3. Pertumbuhan akar rambut kentang Granola dan Wortel pada medium kultur ganda (MM) Hasil yang diperoleh menunjukkan bahwa, bobot kering akar rambut wortel yang ditumbuhkan dalam medium MM lebih tinggi dibandingkan dengan akar rambut kentang Granola. Sehingga dapat dikatakan bahwa di dalam medium

13 42 MM pertumbuhan akar rambut kentang Granola mengalami hambatan, sedang pertumbuhan akar rambut wortel tumbuh baik (Gambar 4.3.). Bobot kering akar rambut (mg) 100,0 90,0 80,0 70,0 60,0 50,0 40,0 30,0 20,0 10,0 0, Umur (minggu) k.granola wortel Gambar 4.3. Diagram pertumbuhan akar rambut pada medium MM pada umur 0,3 dan 6 minggu setelah kultur 3.4. Konfirmasi T-DNA A. rhizogenes dengan teknik PCR A B Hasil elektroforesis akar rambut membentuk pita-pita DNA, selanjutnya digunakan untuk menghitung konsentrasi DNA secara kualitatif (Gambar 4.4.) Gambar 4.4. Elektroforesis total DNA genomik akar rambut dan tanaman kentang Granola, Atlantik, dan wortel Keterangan : (1) Lamda DNA (Standar DNA), (2) plasmid A rhizogenes; (3) kentang Atlantik HR (4) planlet kentang Atlantik, (5) wortel HR, (6). planlet wortel; (7). kentang Granola HR; (8). planlet kentang Granola Hasil Uji konfirmasi T-DNA dalam Akar Rambut kentang Granola, kentang Atlantik dan wortel Hasil uji konfirmasi T-DNA akar rambut kentang Granola, kentang Atlantik dan wortel, digunakan kontrol positif Plasmad A. rhizogenes, dan kontrol negatif digunakan dari tanaman uji tanpa inokulasi A. rhizogenes memberikan hasil dengan membentuk pita-pita DNA (Gambar 4.5.)

14 bp 780 bp Gambar 4.5. Hasil PCR tanaman yang telah ditransformasi Keterangan:(1) Marker 1 kb DNA Ladder (2). Plasmad A. rhizogenes + primer TL, (3). Plasmid A. rhizogenes + primer TR (4). Wortel HR + TL, (5). Wortel HR + TR, (6). kentang Atlantik HR +TL (7) kentang Atlantik HR + TR (8). Tanaman wortel+tl, (9) tanaman wortel + TR (10). tanaman kentang Atlantik +TR (11). Tanaman kentang Atlantik +TL, (12) Tanaman kentang Granola+TL(13) Tanaman kentang Granola +TL, (14) Marker 1 kb DNA Ladder, (15) Plasmid A. rhizogenes + primer + TL (16) Plasmid A. rhizogenes + primer + TR (17) kentang Granola HR +TL, (18)kentang Granola HR+ TR. Profil DNA setelah fraksinasi menunjukkan bahwa semua sampel menghasilkan pola pita yang sama dengan kontrol positif (plasmid), kecuali kontrol negatif (non transforman). Berdasar pola pita terbentuk bagian T-DNA, yaitu TL-DNA dan TR-DNA telah terintegrasi pada semua akar rambut kentang Granola, kentang Atlantik dan Wortel. Bagian TL-DNA (rol B) terlihat pada hasil amplifikasi terletak pada 780 bp, sedang bagian TR-DNA (rol A) pada 1600 bp. 4. PEMBAHASAN 4.1. Seleksi tanaman inang yang mampu membentuk akar rambut Respons dari kelima jenis eksplan terhadap inokulasi A. rhizogenes, menunjukkan bahwa jagung dan sorghum tidak membentuk akar rambut. Sedang pada eksplan kentang Granola, kentang Atlantik dan wortel terjadi induksi pembentukan akar rambut pada bagian yang dilukai tanpa didahului pembentukan kalus, dan dapat tumbuh pada ketiga medium yang digunakan (MS, B5, White). agung dan sorghum tidak memberikan respons terhadap T-DNA A. rhizogenes. Hal ini mungkin karena tanaman monokotil saat dilukai tidak mengeluarkan senyawa aktif misalkan asetosiringon yang berfungsi untuk

15 44 menginduksi gen virulen dari A rhizogenes. Menurut Douglas et al. (1985) secara alami tanaman dilukai akan mengeluarkan senyawa yang dapat menstimulus T- DNA dalam plasmid A. rhizogenes. Senyawa tersebut di antaranya, asam amino, gula, dan senyawa fenolik. Tahapan pelepasan senyawa kimia dari tanaman dan terjadinya gerak kemotoksis dari A. rhizogenes merupakan langkah awal dari infeksi (Christey & Braun 2004). Sedang tanaman wortel, kentang Granola dan Atlantik (dikotil) dapat merespons T-DNA A. rhizogenes, karena tanaman tersebut saat pelukaan dapat menghasilkan senyawa fenolik yang berfungsi merangsang gerak kemotaksis, sehingga terjadi kontak sel yaitu pelekatan plasmid A rhizogenes ke dalam sel tanaman sasaran. Pelekatan tersebut terjadi karena A. rhizogenes memiliki gen virulen tersusun pada tujuh lokus utama, yaitu vir A, vir B, vir C, vir D, vir E, vir G dan vir H (Christey & Braun 2004). Gen virulen diinduksi beberapa senyawa aktif yang disekresikan oleh tanaman yang rentan. Senyawa tersebut adalah asetosiringon, hidroksi asetosiringon, konoferil alkohol, konoferin dan etil firulat (Winans 1992). Induksi berbagai produk gen vir akan menghasilkan utas tunggal linier, yaitu T-DNA yang ditransfer ke dalam sel tanaman. Gen-gen yang tersusun di dalam T-DNA dibedakan menurut peranannya, yaitu gen yang mempengaruhi keseimbangan fitohormon bersifat endogen, dan gen memproduksi opin. Ekspresi dari gen tersebut membentuk akar rambut. Kentang Granola, kentang Atlantik dan wortel merupakan tanaman yang dapat merespons T-DNA A rhizogenes. Pembentukan akar rambut sebagai respons T-DNA A. rhizogenes galur LBA 5947, tidak selalu didahului dengan pembentukan kalus. Respons yang dihasilkan dari tanaman uji, tidak sama dengan tanaman kina, yang didahului dengan terbentuknya kalus (Aneloi 2004). Pembentukan kalus setelah inokulasi tergantung jenis eksplan yang digunakan. Reflini (2002) menyatakan bahwa eksplan batang dapat membentuk akar rambut lebih banyak dibandingkan dengan eksplan daun. Tidak semua eksplan yang diinokulasi, membentuk kalus sebelum menghasilkan akar rambut. Transfer T-DNA ke dalam sel tanaman merupakan proses kompleks dan dipengaruhi oleh berbagai faktor baik tanaman, maupun jenis Agrobacterium. Menurut Gelvin (2000), beberapa faktor perlu diperhatikan untuk keberhasilan

16 45 dan efisiensi transformasi adalah optimasi dan kondisi fisiologi eksplan, komposisi medium, pemilihan jaringan sebagai materi awal, kondisi kokultivasi, serta faktor lingkungan, di antaranya adalah suhu, ph dan cahaya. Infeksi tanaman oleh A. rhizogenes menyebabkan masuknya TL dan atau TR plasmid bakteri, kemudian berintegrasi ke dalam genom tanaman (Saurwein et al. 1999, Bajaj & Ishimaru 1999). Integrasi DNA plasmid Ri ke dalam genom sel tanaman menyebabkan berkembangnya akar adventif pada situs infeksi. Proses pembentukan akar rambut terjadi, karena T-DNA membawa gen rol yang penting untuk menginduksi akar rambut. T-DNA juga pembawa gen penyandi protein, yang berperan di dalam proses biosintesis zat pengatur tumbuh auksin dan sitokinin. Ekspresi gen tersebut menyebabkan adanya keseimbangan baru dari zat pengatur tumbuh internal, sehingga menyebabkan terjadinya induksi akar rambut. Sedang eksplan yang tidak membentuk akar rambut setelah diinduksi disebabkan T-DNA tidak terintegrasi pada sel tanaman (Bajaj & Ishimaru 1999). Pertumbuhan akar rambut hasil transformasi T-DNA A. rhizogenes berbeda dengan akar tanaman. Akar tanaman menunjukkan tipe pertumbuhan akar bersifat geometris positif, sedang akar transforman menunjukkan tipe pertumbuhan geometris negatif. Selain itu akar transforman memiliki percabangan akar yang banyak, sehingga sesuai untuk produksi inokulum G. margarita dan A. tuberculata (CMA uji), yang bersifat obligat. Chabot et al. (1992) menyatakan bahwa kultur akar rambut mempunyai kemampuan melakukan biosintesis seperti akar tanaman normal dengan laju pertumbuhan lebih cepat dan tidak teratur. Sifat lain yang sangat penting dari akar rambut adalah, mudah tumbuh pada media kultur tanpa penambahan zat pengatur tumbuh, dapat tumbuh di dalam media padat maupun cair (Aneloi 2004). Fleksibilitas pertumbuhan pada setiap medium sangat tinggi ( Christey & Braun 2004) Seleksi media pertumbuhan akar rambut kentang dan wortel Berdasarkan bobot kering akar rambut diperoleh adanya interaksi antara jenis medium dan jenis eksplan. Berat kering akar rambut tertinggi diperoleh dari tanaman wortel yang dikulturkan dalam medium White. Sedang pertumbuhan akar rambut kentang terbaik diperoleh dari kentang Granola ditumbuhkan dalam

17 46 medium MS (Tabel 4.2.). Tampaknya untuk petumbuhan akar rambut kedua jenis kentang medium MS memberikan hasil yang terbaik. Hasil yang diperoleh menunjukkan bahwa pertumbuhan akar rambut sangat dipengaruhi oleh jenis tanaman asalnya dan medium kultur yang digunakan. Terlihat bahwa akar rambut kentang tumbuh baik pada medium MS yang memiliki komposisi nutrisi hara lebih lengkap dibandingkan dengan medium B5 dan medium White (Lampiran 1A dan 1B). Sebaliknya akar rambut wortel tumbuh lebih baik dalam medium White, dengan komposisi nutrisi hara lebih sederhana khususnya untuk hara makro. Ridgway et al. (2004) menyatakan bahwa potongan akar rambut wortel diinokulasi dengan A. rhizogenes A4T dapat tumbuh baik dalam medium Lauria-Bertoni (+/- asetosiringon) atau dalam medium Yeast Mannitol. Christey & Braun (2004) menyatakan bahwa wortel adalah salah satu spesies yang sukses dan mudah beradaptasi untuk memproduksi akar rambut Pertumbuhan akar rambut kentang Granola dan Wortel pada medium MM (kultur ganda) Komposisi media kultur ganda sederhana, dengan unsur P yang sangat rendah (4,8 mg/l), sehingga tidak setiap kultur akar rambut mampu beradaptasi. Seleksi terhadap dua kultur akar rambut kentang Granola dan wortel didapatkan pertumbuhan akar rambut wortel jauh lebih cepat dan percabangan akar banyak dibandingkan dengan kentang Granola. Hal tersebut karena akar kentang Granola sudah teradaptasi dan dapat tumbuh dengan baik pada media yang komposisi mediumnya kompleks dan dalam jumlah nutrisi cukup banyak, sedang pada akar rambut wortel, telah tumbuh baik pada media yang mempunyai komposisi sederhana, sehingga tidak terganggu pertumbuhannnya apabila dikultur pada media kultur ganda. Pertumbuhan kultur akar kentang Granola paling baik pada media MS. Hal ini bisa dimengerti karena media MS mempunyai komposisi yang lebih kaya, dibandingkan dengan medium lain. Hal tersebut sesuai dengan pernyataan Giri dan Narasu (2000) bahwa jenis medium memberikan pengaruh yang nyata terhadap induksi akar rambut. Medium mengandung garam dalam jumlah tinggi seperti medium MS, lebih sesuai untuk pembentukan akar rambut pada beberapa

18 47 tanaman. Medium mengandung garam rendah, seperti medium B5 dapat menyebabkan multiplikasi bakteri berlebihan di dalam medium, sehingga memerlukan subkultur eksplan berulang kali dalam medium dekontaminan. Menurut Gunawan (1998) unsur makro media MS merupakan unsur-unsur yang penting dalam pengembangan media lain. Tetapi perbandingan unsur unsur tertentu dari medium MS dapat menentukan pertumbuhan akar lebih baik. Sismunandar & Julianto (2000) menyatakan bahwa vitamin yang ditambahkan ke dalam medium berfungsi mempercepat pembelahan sel pada meristem akar sebagai koenzim yang dapat menghasilkan energi dalam reaksi enzimatis Konfirmasi T-DNA A. rhizogenes dengan teknik PCR Untuk membuktikan bahwa T-DNA A. rhizogenes telah terintegrasi dalam jaringan akar rambut kentang Granola, kentang Atlantik dan tanaman wortel, dilakukan pengujian menggunakan PCR. Sebagai pembanding digunakan kontrol positif DNA dari plasmid A. rhizogenes dan kontrol negatif DNA tanaman yang tidak ditransformasi. Profil DNA setelah fraksinasi menggunakan elektroforesis, pada semua sampel menghasilkan pola pita sama dengan kontrol positif (plasmid), kecuali kontrol negatif (non transforman). Dari pola pita tersebut menunjukkan bahwa kedua bagian T-DNA yaitu TL-DNA dan TR-DNA telah terintegrasi pada akar rambut kentang Granola, kentang Atlantik dan wortel. Bagian TL-DNA (rol B) terletak pada posisi 780 bp, sedang bagian TR- DNA (rol A) terlihat pada posisi 1600 bp. Hal tersebut sesuai dengan hasil penelitian tanaman Cinchonia legendaris dan C. succirubra (Aneloi 2004, Toruan-Mathius et al. 2004).

19 48 5. SIMPULAN 1. Akar rambut dapat diinduksi dari eksplan tanaman wortel, kentang Granola dan kentang Atlantik menggunakan A. rhizogenes galur LBA 9475, yang dikulturkan dalam medium MS, B5 dan white. 2. Medium MS terbaik untuk pertumbuhan akar rambut kentang Granola dan kentang Atlantik, sedang medium White baik untuk pertumbuhan akar rambut wortel. 3. Akar rambut wortel berkembang baik dalam medium MM (kultur ganda), sedang pertumbuhan akar rambut kentang Granola mengalami hambatan. 4. Berdasarkan uji konfirmasi transfer T-DNA dengan PCR terdapat dua pola pita ukuran basa 780 pb TL dan 1600 pb TR, menunjukkan bahwa TL dan TR- DNA telah terintegrasi pada akar rambut.

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN A. Jenis Penelitian deskriptif. Jenis penelitian yang digunakan adalah penelitian dasar dengan metode B. Objek Penelitian Objek penelitian ini adalah sampel DNA koleksi hasil

Lebih terperinci

BAHAN DAN METODE Tempat dan Waktu Penelitian Peremajaan Isolat Pengujian Antagonisme R. pickettii terhadap R. solani

BAHAN DAN METODE Tempat dan Waktu Penelitian Peremajaan Isolat Pengujian Antagonisme R. pickettii terhadap R. solani BAHAN DAN METODE Tempat dan Waktu Penelitian Penelitian ini dilaksanakan di Laboratorium Bakteriologi Tumbuhan Departemen Proteksi Tanaman, Fakultas Pertanian, Institut Pertanian Bogor. Waktu pelaksanaan

Lebih terperinci

BAB III METODE PENELITIAN. Dalam penelitian ini dilakukan lima tahap utama yang meliputi tahap

BAB III METODE PENELITIAN. Dalam penelitian ini dilakukan lima tahap utama yang meliputi tahap BAB III METODE PENELITIAN Dalam penelitian ini dilakukan lima tahap utama yang meliputi tahap penyiapan templat mtdna, amplifikasi fragmen mtdna pada daerah D-loop mtdna manusia dengan teknik PCR, deteksi

Lebih terperinci

FAKULTAS BIOLOGI LABORATORIUM GENETIKA & PEMULIAAN INSTRUKSI KERJA UJI

FAKULTAS BIOLOGI LABORATORIUM GENETIKA & PEMULIAAN INSTRUKSI KERJA UJI ISOLASI TOTAL DNA TUMBUHAN DENGAN KIT EKSTRAKSI DNA PHYTOPURE Halaman : 1 dari 5 1. RUANG LINGKUP Metode ini digunakan untuk mengisolasi DNA dari sampel jaringan tumbuhan, dapat dari daun, akar, batang,

Lebih terperinci

BAB III. METODOLOGI PENELITIAN. Pengambilan sampel. Penyiapan templat mtdna dengan metode lisis sel

BAB III. METODOLOGI PENELITIAN. Pengambilan sampel. Penyiapan templat mtdna dengan metode lisis sel 16 BAB III. METODOLOGI PENELITIAN Bab ini menggambarkan tahapan penelitian yang terdiri dari pengambilan sampel, penyiapan templat mtdna dengan metode lisis sel, amplifikasi D-loop mtdna dengan teknik

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN A. Jenis Penelitian Penelitian ini merupakan penelitian murni yang dilakukan dengan metode deskriptif, yaitu suatu metode penelitian untuk membuat deskripsi, gambaran atau lukisan

Lebih terperinci

3. METODE PENELITIAN

3. METODE PENELITIAN 19 3. METODE PENELITIAN 3.1 Waktu dan Tempat Penelitian ini dilaksanakan pada bulan Maret sampai Juni 2010 di Laboratorium Mikrobiologi, Biokimia dan Bioteknologi Hasil Perairan Departemen Teknologi Hasil

Lebih terperinci

Asam Asetat Glacial = 5,7 ml EDTA 0,5 M ph 8.0 = 10 ml Aquades ditambahkan hingga volume larutan 100 ml

Asam Asetat Glacial = 5,7 ml EDTA 0,5 M ph 8.0 = 10 ml Aquades ditambahkan hingga volume larutan 100 ml 36 Lampiran 1. Pembuatan Larutan Stok dan Buffer A. Pembuatan Larutan Stok Tris HCL 1 M ph 8.0 (100 ml) : Timbang Tris sebanyak 12,114 g. Masukkan Tris ke dalam Erlenmeyer dan ditambahkan 80 ml aquades.

Lebih terperinci

BAB III METODE PENELITIAN. amplifikasi daerah HVI mtdna sampel dengan menggunakan teknik PCR;

BAB III METODE PENELITIAN. amplifikasi daerah HVI mtdna sampel dengan menggunakan teknik PCR; BAB III METODE PENELITIAN Secara garis besar, langkah-langkah yang dilakukan dalam penelitian ini adalah: pengumpulan sampel; lisis terhadap sampel mtdna yang telah diperoleh; amplifikasi daerah HVI mtdna

Lebih terperinci

BAB III METODE PENELITIAN. Secara garis besar langkah-langkah yang dilakukan dalam penelitian ini

BAB III METODE PENELITIAN. Secara garis besar langkah-langkah yang dilakukan dalam penelitian ini BAB III METODE PENELITIAN Secara garis besar langkah-langkah yang dilakukan dalam penelitian ini adalah: pengumpulan sampel; lisis terhadap sampel mtdna yang telah diperoleh; amplifikasi daerah D-loop

Lebih terperinci

BAHAN DAN METODE Tempat dan Waktu Penelitian Persiapan Tanaman Padi Perbanyakan Masal Nephotettix virescens

BAHAN DAN METODE Tempat dan Waktu Penelitian Persiapan Tanaman Padi Perbanyakan Masal Nephotettix virescens BAHAN DAN METODE Tempat dan Waktu Penelitian Penelitian ini dilaksanakan di Rumah Kaca Cikabayan dan Laboratorium Virologi Tumbuhan, Departemen Proteksi Tanaman, Fakultas Pertanian, Institut Pertanian

Lebih terperinci

HASIL DAN PEMBAHASAN. eksplan hidup, persentase eksplan browning, persentase eksplan kontaminasi,

HASIL DAN PEMBAHASAN. eksplan hidup, persentase eksplan browning, persentase eksplan kontaminasi, IV. HASIL DAN PEMBAHASAN Pengamatan terhadap proses induksi akar pada eksplan dilakukan selama 12 minggu. Pengamatan dilakukan untuk mengetahui pertumbuhan dan pengaruh pada setiap perlakuan yang diberikan.

Lebih terperinci

BAHAN DAN METODE Tempat dan Waktu Penelitian Bahan dan Alat

BAHAN DAN METODE Tempat dan Waktu Penelitian Bahan dan Alat 12 BAHAN DAN METODE Tempat dan Waktu Penelitian Survei penyakit klorosis dan koleksi sampel tanaman tomat sakit dilakukan di sentra produksi tomat di daerah Cianjur, Cipanas, Lembang, dan Garut. Deteksi

Lebih terperinci

BAB III METODE PENELITIAN Bagan Alir Penelitian ini secara umum dapat digambarkan pada skema berikut:

BAB III METODE PENELITIAN Bagan Alir Penelitian ini secara umum dapat digambarkan pada skema berikut: BAB III METODE PENELITIAN Tahapan-tahapan yang dilakukan dalam penelitian ini adalah: pengumpulan sampel, lisis terhadap sampel mtdna yang telah diperoleh, amplifikasi daerah HVI mtdna sampel dengan menggunakan

Lebih terperinci

VISUALISASI HASIL PCR DENGAN METODE PCR LANGSUNG DAN TIDAK LANGSUNG PADA SAMPEL BAKTERI Pseudomonas fluorescens dan Ralstonia solanacearum

VISUALISASI HASIL PCR DENGAN METODE PCR LANGSUNG DAN TIDAK LANGSUNG PADA SAMPEL BAKTERI Pseudomonas fluorescens dan Ralstonia solanacearum VISUALISASI HASIL PCR DENGAN METODE PCR LANGSUNG DAN TIDAK LANGSUNG PADA SAMPEL BAKTERI Pseudomonas fluorescens dan Ralstonia solanacearum Pendahuluan Polymerase Chain Reaction (PCR) adalah suatu teknik

Lebih terperinci

BAB III METODOLOGI PENELITIAN. Penelitian akan diawali dengan preparasi alat dan bahan untuk sampling

BAB III METODOLOGI PENELITIAN. Penelitian akan diawali dengan preparasi alat dan bahan untuk sampling 16 BAB III METODOLOGI PENELITIAN Penelitian akan diawali dengan preparasi alat dan bahan untuk sampling sel folikel akar rambut. Sampel kemudian dilisis, diamplifikasi dan disekuensing dengan metode dideoksi

Lebih terperinci

LAMPIRAN. Lampiran 1. Deskripsi Pembuatan Larutan Stok dan Buffer

LAMPIRAN. Lampiran 1. Deskripsi Pembuatan Larutan Stok dan Buffer LAMPIRAN Lampiran 1. Deskripsi Pembuatan Larutan Stok dan Buffer 1. Pembuatan Larutan Stok a. CTAB 5 % Larutan dibuat dengan melarutkan : - NaCl : 2.0 gr - CTAB : 5.0 gr - Aquades : 100 ml b. Tris HCl

Lebih terperinci

Pembuatan Larutan Stok, Media Kultur Dan Sterilisasi Alat Kultur Jaringan Tumbuhan. Nikman Azmin

Pembuatan Larutan Stok, Media Kultur Dan Sterilisasi Alat Kultur Jaringan Tumbuhan. Nikman Azmin Pembuatan Larutan Stok, Media Kultur Dan Sterilisasi Alat Kultur Nikman Azmin Abstrak; Kultur jaringan menjadi teknologi yang sangat menentukan keberhasilan dalam pemenuhan bibit. Kultur jaringan merupakan

Lebih terperinci

METODOLOGI PENELITIAN

METODOLOGI PENELITIAN 22 METODOLOGI PENELITIAN Waktu dan Tempat Penelitian ini dilaksanakan mulai bulan Januari 2010 sampai dengan Pebruari 2011. Tempat pelaksanaan kultur jaringan tanaman adalah di Laboratorium Kultur Jaringan

Lebih terperinci

Pembuatan Media Kultur Bakteri Pemanenan sel bakteri. Isolasi DNA kromosom bakteri. Kloning DNA

Pembuatan Media Kultur Bakteri Pemanenan sel bakteri. Isolasi DNA kromosom bakteri. Kloning DNA LAMPIRAN 15 15 Lampiran 1 Tahapan penelitian Pembuatan Media Kultur Bakteri Pemanenan sel bakteri Isolasi DNA kromosom bakteri Pemotongan DNA dengan enzim restriksi Kloning DNA Isolasi DNA plasmid hasil

Lebih terperinci

III. BAHAN DAN METODE

III. BAHAN DAN METODE III. BAHAN DAN METODE Tempat dan Waktu Penelitian dilakukan di Laboratorium BIORIN (Biotechnology Research Indonesian - The Netherlands) Pusat Penelitian Sumberdaya Hayati dan Bioteknologi IPB. Penelitian

Lebih terperinci

BAHAN DAN METODE Waktu dan Tempat Penelitian Bahan dan Alat Metode Penelitian

BAHAN DAN METODE Waktu dan Tempat Penelitian Bahan dan Alat Metode Penelitian 14 BAHAN DAN METODE Waktu dan Tempat Penelitian Penelitian dilakukan pada bulan Oktober 2009 sampai dengan bulan Juni 2011 di Laboratorium Kultur Jaringan Kelompok Peneliti Biologi Sel dan Jaringan, Balai

Lebih terperinci

BAHAN DAN METODE Waktu dan Tempat Bahan Metode Isolasi C. gloeosporioides dari Buah Avokad

BAHAN DAN METODE Waktu dan Tempat Bahan Metode Isolasi C. gloeosporioides dari Buah Avokad 15 BAHAN DAN METODE Waktu dan Tempat Penelitian dilaksanakan di Laboratorium Balai Besar Karantina Pertanian (BBKP) Tanjung Priok Wilayah Kerja Bogor, mulai bulan Oktober 2011 sampai Februari 2012. Bahan

Lebih terperinci

Pengambilan sampel tanah dari lahan tambang timah di Belitung. Isolasi bakteri pengoksidasi besi dan sulfur. Pemurnian isolat bakteri

Pengambilan sampel tanah dari lahan tambang timah di Belitung. Isolasi bakteri pengoksidasi besi dan sulfur. Pemurnian isolat bakteri Lampiran 1. Skema Kerja Penelitian Pengambilan sampel tanah dari lahan tambang timah di Belitung Isolasi bakteri pengoksidasi besi dan sulfur Pemurnian isolat bakteri Karakteriasi isolat bakteri pengoksidasi

Lebih terperinci

BAB III METODE PENELITIAN. bersifat eksperimen karena pada penelitian menggunakan kontrol yaitu

BAB III METODE PENELITIAN. bersifat eksperimen karena pada penelitian menggunakan kontrol yaitu 30 BAB III METODE PENELITIAN A. Jenis Penelitian Jenis penelitian yang dilakukan termasuk ke dalam penelitian yang bersifat eksperimen karena pada penelitian menggunakan kontrol yaitu pada medium Murashige-Skoog

Lebih terperinci

TINJAUAN PUSTAKA. dalam kelas Liliopsida yang merupakan salah satu tumbuhan berbunga lidah dari

TINJAUAN PUSTAKA. dalam kelas Liliopsida yang merupakan salah satu tumbuhan berbunga lidah dari TINJAUAN PUSTAKA Botani Tanaman Menurut Jones dan Luchsinger (1979), tumbuhan anggrek termasuk ke dalam kelas Liliopsida yang merupakan salah satu tumbuhan berbunga lidah dari sekian banyak tumbuhan berbunga

Lebih terperinci

BAB III METODOLOGI PENELITIAN. Pada penelitian ini terdapat lima tahapan penelitian yang dilakukan yaitu

BAB III METODOLOGI PENELITIAN. Pada penelitian ini terdapat lima tahapan penelitian yang dilakukan yaitu BAB III METODOLOGI PENELITIAN Pada penelitian ini terdapat lima tahapan penelitian yang dilakukan yaitu pengumpulan sampel berupa akar rambut, ekstraksi mtdna melalui proses lisis akar rambut, amplifikasi

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN 3.1 Waktu dan Tempat Penelitian ini dilaksanakan pada bulan Januari 2012 sampai bulan Juli 2012, yang bertempat di Laboratorium Genetika dan Biologi Molekuler Jurusan Biologi

Lebih terperinci

BAB III METODE PENELITIAN. Penelitian ini merupakan penelitian eksperimental dengan 7 sampel dari 7

BAB III METODE PENELITIAN. Penelitian ini merupakan penelitian eksperimental dengan 7 sampel dari 7 BAB III METODE PENELITIAN 3.1 Rancangan Penelitian Penelitian ini merupakan penelitian eksperimental dengan 7 sampel dari 7 individu udang Jari yang diambil dari Segara Anakan Kabupaten Cilacap Jawa Tengah.

Lebih terperinci

BAHAN DAN METODE. Tempat dan Waktu

BAHAN DAN METODE. Tempat dan Waktu BAHAN DAN METODE Tempat dan Waktu Penelitian dilaksanakan di Laboratorium Kultur Jaringan Kelompok Peneliti Biologi Sel dan Jaringan, Balai Besar Penelitian dan Pengembangan Bioteknologi dan Sumberdaya

Lebih terperinci

BAHAN DAN METODE. tumefaciens LBA4404 yang membawa gen xyloglucanase, gen nptii, dan

BAHAN DAN METODE. tumefaciens LBA4404 yang membawa gen xyloglucanase, gen nptii, dan BAHAN DAN METODE Tempat dan Waktu Penelitian dilaksanakan di laboratorium Biologi Molekuler Tanaman, Pusat Penelitian Bioteknologi - LIPI, Cibinong, mulai bulan Agustus 2006 sarnpai dengan Agustus 2007.

Lebih terperinci

IV. HASIL ANALISIS DAN PEMBAHASAN. Air leri merupakan bahan organik dengan kandungan fosfor, magnesium

IV. HASIL ANALISIS DAN PEMBAHASAN. Air leri merupakan bahan organik dengan kandungan fosfor, magnesium IV. HASIL ANALISIS DAN PEMBAHASAN Air leri merupakan bahan organik dengan kandungan fosfor, magnesium dan vitamin B1 yang efektif bila dimanfaatkan sebagai bahan tambahan pada proses perbanyakan tanaman

Lebih terperinci

III. Bahan dan Metode

III. Bahan dan Metode III. Bahan dan Metode A. Waktu dan Tempat Penelitian Penelitian ini dilaksanakan selama 3 bulan dari bulan Mei-Juli 2011 yang dilakukan di LPPT UGM Yogyakarta. B. Bahan Penelitian Sampel yang digunakan

Lebih terperinci

BAB III METODE PENELITIAN. Jenis penelitian yang dilakukan termasuk dalam penelitian dasar yang. dilakukan dengan metode deskriptif (Nazir, 1998).

BAB III METODE PENELITIAN. Jenis penelitian yang dilakukan termasuk dalam penelitian dasar yang. dilakukan dengan metode deskriptif (Nazir, 1998). BAB III METODE PENELITIAN A. Jenis Penelitian Jenis penelitian yang dilakukan termasuk dalam penelitian dasar yang dilakukan dengan metode deskriptif (Nazir, 1998). B. Populasi dan Sampel 1. Populasi yang

Lebih terperinci

3 Metodologi Penelitian

3 Metodologi Penelitian 3 Metodologi Penelitian 3.1 Alat Penelitian ini dilakukan di Laboratorium Penelitian Biokimia, Program Studi Kimia, Institut Teknologi Bandung. Peralatan yang digunakan pada penelitian ini diantaranya

Lebih terperinci

I. PENDAHULUAN. Kacang tanah (Arachis hypogaea L.) memiliki peran strategis dalam pangan

I. PENDAHULUAN. Kacang tanah (Arachis hypogaea L.) memiliki peran strategis dalam pangan I. PENDAHULUAN 1.1 Latar Belakang Kacang tanah (Arachis hypogaea L.) memiliki peran strategis dalam pangan nasional sebagai sumber protein dan minyak nabati, dalam setiap 100 g kacang tanah mentah mengandung

Lebih terperinci

LAMPIRAN. Lampiran 1. Pembuatan Larutan Stok dan Buffer

LAMPIRAN. Lampiran 1. Pembuatan Larutan Stok dan Buffer LAMPIRAN Lampiran 1. Pembuatan Larutan Stok dan Buffer A. LARUTAN STOK CTAB 5 % (100 ml) - Ditimbang NaCl sebanyak 2.0 gram - Ditimbang CTAB sebanyak 5.0 gram. - Dimasukkan bahan kimia ke dalam erlenmeyer

Lebih terperinci

BAHA DA METODE Tempat dan Waktu Bahan dan Alat Metode Penelitian

BAHA DA METODE Tempat dan Waktu Bahan dan Alat Metode Penelitian BAHA DA METODE Tempat dan Waktu Penelitian ini dilaksanakan di Laboratorium Bioteknologi Tanaman Departemen Agronomi dan Hortikultura Fakultas Pertanian, Institut Pertanian Bogor. Penelitian ini dimulai

Lebih terperinci

BAB III METODE PENELITIAN. eksplorasi dengan cara menggunakan isolasi jamur endofit dari akar kentang

BAB III METODE PENELITIAN. eksplorasi dengan cara menggunakan isolasi jamur endofit dari akar kentang BAB III METODE PENELITIAN 3.1 Rancangan Penelitian Jenis penelitian ini adalah penelitian eksplorasi dan eksperimen. Penelitian eksplorasi dengan cara menggunakan isolasi jamur endofit dari akar kentang

Lebih terperinci

III. METODE PENELITIAN

III. METODE PENELITIAN III. METODE PEELITIA 3.1 Tempat dan Waktu Penelitian Penelitian ini dilaksanakan di Balai Pengkajian Bioteknologi, Badan Pengkajian dan Penerapan Teknologi (BPPT), Serpong, Tangerang. Penelitian dilaksanakan

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN A. Jenis Penelitian Jenis penelitian ini adalah penelitian deskriptif yang mengangkat fenomena alam sebagai salah satu masalah dalam penelitian. Penelitian ini dapat menerangkan

Lebih terperinci

BAHAN DAN METODE Waktu dan Tempat Bahan dan Alat

BAHAN DAN METODE Waktu dan Tempat Bahan dan Alat BAHAN DAN METODE Waktu dan Tempat Penelitian ini dilaksanakan pada bulan Juni 2010 sampai dengan bulan Oktober 2010 di Laboraturium Bioteknologi Tanaman, Departemen Agronomi dan Hortikultura, Fakultas

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN 1 BAB III METODE PENELITIAN A. Jenis Penelitian Jenis penelitian yang dilakukan adalah eksperimen, karena penelitian ini dilakukan dengan memberikan suatu manipulasi terhadap objek penelitian serta adanya

Lebih terperinci

BAHAN DAN METODE Tempat dan Waktu Bahan dan Alat Metode Penelitian Isolasi Aktinomiset

BAHAN DAN METODE Tempat dan Waktu Bahan dan Alat Metode Penelitian Isolasi Aktinomiset BAHAN DAN METODE Tempat dan Waktu Penelitian dilaksanakan di Laboratorium Bakteriologi Tumbuhan, Departemen Proteksi Tanaman, Fakultas Pertanian, Institut Pertanian Bogor, dari bulan Februari sampai dengan

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN 3.1 Waktu dan Lokasi Penelitian Penelitian dilakukan pada 4 April 2016 sampai 16 Agustus 2016. Penelitian ini dilaksanakan di Laboratorium Riset Kimia Material dan Hayati Departemen

Lebih terperinci

BAB VI PENDETEKSIAN PERUBAHAN SEKUENS DNA PADA KELAPA SAWIT ABNORMAL DENGAN TEKNIK RAPD ABSTRAK

BAB VI PENDETEKSIAN PERUBAHAN SEKUENS DNA PADA KELAPA SAWIT ABNORMAL DENGAN TEKNIK RAPD ABSTRAK 116 BAB VI PENDETEKSIAN PERUBAHAN SEKUENS DNA PADA KELAPA SAWIT ABNORMAL DENGAN TEKNIK RAPD ABSTRAK Jaringan daun kelapa sawit hasil kultur jaringan dibuktikan mengalami hipometilasi, sedangkan jaringan

Lebih terperinci

II. BAHAN DAN METODE. Betina BEST BB NB RB. Nirwana BN NN RN. Red NIFI BR NR RR

II. BAHAN DAN METODE. Betina BEST BB NB RB. Nirwana BN NN RN. Red NIFI BR NR RR II. BAHAN DAN METODE Ikan Uji Ikan uji yang digunakan adalah ikan nila hibrida hasil persilangan resiprok 3 strain BEST, Nirwana dan Red NIFI koleksi Balai Riset Perikanan Budidaya Air Tawar Sempur, Bogor.

Lebih terperinci

METODE PENELITIAN. A. Tempat dan Waktu

METODE PENELITIAN. A. Tempat dan Waktu 10 III. METODE PENELITIAN A. Tempat dan Waktu Penelitian dilaksanakan pada bulan September 2015 sampai Februari 2016. Isolasi dan visualisasi RNA Colletrotichum dilaksanakan di Laboratorium Hama Penyakit

Lebih terperinci

Produksi Senyawa Metabolit Sekunder Melalui Kultur Jaringan dan Transformasi Genetik Artemisia Annua L.

Produksi Senyawa Metabolit Sekunder Melalui Kultur Jaringan dan Transformasi Genetik Artemisia Annua L. Produksi Senyawa Metabolit Sekunder Melalui Kultur Jaringan dan Transformasi Genetik Artemisia Annua L. Meilina Marsinta Manalu, Komar Ruslan Wirasutisna, *Elfahmi Kelompok Keilmuan Biologi Farmasi, Sekolah

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN 39 BAB III METODE PENELITIAN A. Desain Penelitian Penelitian yang dilakukan merupakan penelitian deskriptif. Penelitian membuat deskripsi secara sistematis, faktual dan akurat mengenai fakta-fakta dan

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN A. Jenis penelitian Jenis penelitian ini adalah penelitian deskriptif yang mengangkat fenomena alam sebagai salah satu masalah dalam penelitian, sehingga dapat menerangkan arti

Lebih terperinci

FAKULTAS BIOLOGI LABORATORIUM GENETIKA & PEMULIAAN INSTRUKSI KERJA UJI

FAKULTAS BIOLOGI LABORATORIUM GENETIKA & PEMULIAAN INSTRUKSI KERJA UJI Halaman : 1 dari 5 ISOLASI TOTAL DNA HEWAN DENGAN KIT EKSTRAKSI DNA 1. RUANG LINGKUP Metode ini digunakan untuk mengisolasi DNA dari sampel jaringan hewan, dapat dari insang, otot, darah atau jaringan

Lebih terperinci

Universitas Sumatera Utara. D2 Dairi/Sidikalang/Hutarakyat N: , Merah 0,5 E:

Universitas Sumatera Utara. D2 Dairi/Sidikalang/Hutarakyat N: , Merah 0,5 E: Lampiran. 1 Data Geografis dan Morfologis Andaliman No. Kabupaten/Kecamatan/Kota Titik koordinat Ketinggian Tinggi lilit Warna Umur Aksesi Tempat Tanaman Batang Daun Tanaman (mdpl.) (cm) (cm) (cm) D1 Dairi/Sidikalang/Hutarakyat

Lebih terperinci

BAHAN DAN METODE. Pertanian Universitas Sumatera Utara, Medan dengan ketinggian tempat + 25

BAHAN DAN METODE. Pertanian Universitas Sumatera Utara, Medan dengan ketinggian tempat + 25 BAHAN DAN METODE Tempat dan Waktu Penelitian Penelitian ini dilaksanakan di Laboratorium Penyakit Tumbuhan Fakultas Pertanian, Medan dengan ketinggian tempat + 25 meter di atas permukaan laut pada bulan

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN A. Jenis Penelitian Jenis penelitian yang digunakan adalah penelitian dasar dengan metode deskriptif (Nazir, 1983). B. Populasi dan Sampel Populasi dalam penelitian ini adalah

Lebih terperinci

BAB III METODE PENELITIAN. Desain penelitian yang digunakan dalam penelitian ini adalah desain

BAB III METODE PENELITIAN. Desain penelitian yang digunakan dalam penelitian ini adalah desain BAB III METODE PENELITIAN A. Desain Penelitian Desain penelitian yang digunakan dalam penelitian ini adalah desain eksperimen. Menurut Nasution (2009) desain eksperimen yaitu penelitian yang dilakukan

Lebih terperinci

II. MATERI DAN METODE. Tempat pengambilan sampel daun jati (Tectona grandis Linn. f.) dilakukan di

II. MATERI DAN METODE. Tempat pengambilan sampel daun jati (Tectona grandis Linn. f.) dilakukan di II. MATERI DAN METODE 2.1 Waktu dan Tempat Penelitian Tempat pengambilan sampel daun jati (Tectona grandis Linn. f.) dilakukan di enam desa yaitu tiga desa di Kecamatan Grokgak dan tiga desa di Kecamatan

Lebih terperinci

4 HASIL DAN PEMBAHASAN

4 HASIL DAN PEMBAHASAN 17 4 HASIL DAN PEMBAHASAN Konstruksi plasmid biner pmsh1-lisozim Konstruksi plasmid biner dilakukan dengan meligasi gen lisozim ayam dan pmsh1. Plasmid hasil ligasi berukuran 13.449 pb (Gambar 5A kolom

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN A. RANCANGAN PENELITIAN Penelitian ini merupakan penelitian eksperimen yang dilaksanakan dengan Rancangan Acak Lengkap Faktorial dua faktor yaitu faktor kombinasi larutan enzim

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN 25 BAB III METODE PENELITIAN 3.1 Waktu dan Tempat Penelitian telah berlangsung sejak bulan Januari 2012 - Juli 2012 di Laboratorium Mikrobiologi, Lab. Optik, Lab. Genetika dan Lab. Biologi Molekuler Jurusan

Lebih terperinci

LAPORAN PRAKTIKUM REKAYASA GENETIKA

LAPORAN PRAKTIKUM REKAYASA GENETIKA LAPORAN PRAKTIKUM REKAYASA GENETIKA LAPORAN II (ISOLASI DNA GENOM) KHAIRUL ANAM P051090031/BTK BIOTEKNOLOGI SEKOLAH PASCASARJANA INSTITUT PERTANIAN BOGOR 2010 0 ISOLASI DAN IDENTIFIKASI DNA SEL MUKOSA

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN 26 A. Jenis Penelitian BAB III METODE PENELITIAN Jenis Penelitian yang dilakukan merupakan penelitian eksperimen. Penelitian eksperimen merupakan metode penelitian yang digunakan untuk mengetahui pengaruh

Lebih terperinci

II. BAHAN DAN METODE

II. BAHAN DAN METODE II. BAHAN DAN METODE 2.1 Rancangan Perlakuan Penelitian ini terdiri dari enam perlakuan yang masing-masing diberi 3 kali ulangan. Perlakuan yang diberikan berupa perendaman dengan dosis relhp berbeda yaitu

Lebih terperinci

BAHAN DAN METODE Waktu dan Tempat Bahan dan alat

BAHAN DAN METODE Waktu dan Tempat Bahan dan alat BAHAN DAN METODE Waktu dan Tempat Penelitian ini dilaksanakan di Laboratorium Bioteknologi Tanaman Departemen Agronomi dan Hortikultura, Fakultas Pertanian, Institut Pertanian Bogor, mulai bulan Juni sampai

Lebih terperinci

BAHAN DAN METODE Tempat dan Waktu Penyediaan Isolat dan Karakterisasi Bakteri Xanthomonas campestris

BAHAN DAN METODE Tempat dan Waktu Penyediaan Isolat dan Karakterisasi Bakteri Xanthomonas campestris 12 BAHAN DAN METODE Tempat dan Waktu Penelitian dilaksanakan mulai Nopember 2011 sampai dengan Maret 2012 di Laboratorium Bakteriologi Tumbuhan dan Laboratorium Fisiologi dan Toksikologi Serangga Departemen

Lebih terperinci

Kultur Jaringan Menjadi Teknologi yang Potensial untuk Perbanyakan Vegetatif Tanaman Jambu Mete Di Masa Mendatang

Kultur Jaringan Menjadi Teknologi yang Potensial untuk Perbanyakan Vegetatif Tanaman Jambu Mete Di Masa Mendatang AgroinovasI Kultur Jaringan Menjadi Teknologi yang Potensial untuk Perbanyakan Vegetatif Tanaman Jambu Mete Di Masa Mendatang Tanaman jambu mete (Anacardium occidentale. L.) merupakan salah satu tanaman

Lebih terperinci

BAHAN DAN METODE. Perspex strip), mikropipet (1-10 µl; µl; µl), tube. elektroforesis, timbangan analitik dan kamera.

BAHAN DAN METODE. Perspex strip), mikropipet (1-10 µl; µl; µl), tube. elektroforesis, timbangan analitik dan kamera. III. BAHAN DAN METODE 2.1 Tempat dan Waktu Pelaksanaan Penelitian ini dilakukan di Laboratorium Bioteknologi Universitas Muhammadiyah Malang, waktu pelaksanaan mulai bulan April sampai Agustus 2016. 2.2

Lebih terperinci

HASIL DAN PEMBAHASAN Transformasi, Kokultivasi, dan Regenerasi

HASIL DAN PEMBAHASAN Transformasi, Kokultivasi, dan Regenerasi 26 HASIL DAN PEMBAHASAN Transformasi, Kokultivasi, dan Regenerasi Konstruksi vektor ekspresi yang digunakan pada penelitian ini adalah p35scamv::tclfy. Promoter p35s CaMV digunakan dalam penelitian ini

Lebih terperinci

LAPORAN BIOTEKNOLOGI KULTUR ORGAN_by. Fitman_006 LAPORAN PRAKTIKUM BIOTEKNOLOGI PERTANIAN. Kultur Organ OLEH : FITMAN D1B

LAPORAN BIOTEKNOLOGI KULTUR ORGAN_by. Fitman_006 LAPORAN PRAKTIKUM BIOTEKNOLOGI PERTANIAN. Kultur Organ OLEH : FITMAN D1B LAPORAN BIOTEKNOLOGI KULTUR ORGAN_by. Fitman_006 LAPORAN PRAKTIKUM BIOTEKNOLOGI PERTANIAN Kultur Organ OLEH : FITMAN D1B1 12 067 PROGRAM STUDI AGROTEKNOLOGI JURUSAN AGROTEKNOLOGI FAKULTAS PERTANIAN UNIVERSITAS

Lebih terperinci

4 HASIL DAN PEMBAHASAN. 4.1 Transformasi genetik Oryza sativa L. dengan gen MaMt2

4 HASIL DAN PEMBAHASAN. 4.1 Transformasi genetik Oryza sativa L. dengan gen MaMt2 27 4 HASIL DAN PEMBAHASAN 4.1 Transformasi genetik Oryza sativa L. dengan gen MaMt2 Transformasi genetik Oryza sativa L. kultivar Kasalath dan Nipponbare dilakukan menggunakan eksplan yang berupa kalus

Lebih terperinci

BAB I PENDAHULUAN Latar Belakang

BAB I PENDAHULUAN Latar Belakang 1 BAB I PENDAHULUAN Latar Belakang Pisang merupakan salah satu jenis tanaman asal Asia Tenggara yang kini sudah tersebar luas ke seluruh dunia, termasuk Indonesia. Tanaman pisang memiliki ciri spesifik

Lebih terperinci

GAHARU. Dr. Joko Prayitno MSc. Balai Teknologi Lingkungan Badan Pengkajian dan Penerapan Teknologi

GAHARU. Dr. Joko Prayitno MSc. Balai Teknologi Lingkungan Badan Pengkajian dan Penerapan Teknologi Kuliah 11 KULTUR JARINGAN GAHARU Dr. Joko Prayitno MSc. Balai Teknologi Lingkungan Badan Pengkajian dan Penerapan Teknologi KULTUR JARINGAN Apa yang dimaksud dengan kultur jaringan? Teknik menumbuhkan

Lebih terperinci

BAB III METODE PENELITIAN. Rancangan acak lengkap (RAL) faktorial dengan 2 faktor yaitu:

BAB III METODE PENELITIAN. Rancangan acak lengkap (RAL) faktorial dengan 2 faktor yaitu: BAB III METODE PENELITIAN 3.1 Rancangan Penelitian Penelitian ini termasuk penelitian eskperimental yang menggunakan Rancangan acak lengkap (RAL) faktorial dengan 2 faktor yaitu: 1. Faktor pertama: konsentrasi

Lebih terperinci

TINJAUAN PUSTAKA Kultur Jaringan Tanaman Eksplan

TINJAUAN PUSTAKA Kultur Jaringan Tanaman Eksplan TINJAUAN PUSTAKA Kultur Jaringan Tanaman Kultur in vitro merupakan suatu budidaya dalam botol. Salah satu kegiatan dalam kultur in vitro adalah kultur jaringan yaitu budidaya in vitro yang menggunakan

Lebih terperinci

BAHAN DAN METODE Alat dan Bahan Penelitian Lokasi dan Waktu Penelitian Prosedur Percobaan

BAHAN DAN METODE Alat dan Bahan Penelitian Lokasi dan Waktu Penelitian Prosedur Percobaan BAHAN DAN METODE Alat dan Bahan Penelitian Bahan yang digunakan dalam penelitian ini adalah benih kedelai varietas Kaba dengan dengan deskripsi varietas pada Lampiran 1. Viabilitas awal benih yang digunakan

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN A. Jenis Penelitian Jenis peleitian yang dilakukan merupakan penelitian eksperimen. Penelitian eksperimen adalah metode penelitian yang dilakukan dengan memanipulasi objek penelitian

Lebih terperinci

BAHAN DAN METODE. Tempat dan Waktu. Bahan Tanaman dan Media

BAHAN DAN METODE. Tempat dan Waktu. Bahan Tanaman dan Media BAHAN DAN METODE Tempat dan Waktu Penelitian ini dilakukan di Laboratorium Bioteknologi Tanaman, Departemen Agronomi dan Hortikultura, Fakultas Pertanian, Institut Pertanian Bogor. Penelitian dilaksanakan

Lebih terperinci

BAB III METODE PENELITIAN

BAB III METODE PENELITIAN BAB III METODE PENELITIAN 3.1 Rancangan Penelitian Penelitian ini termasuk jenis penelitian eksperimental menggunakan Rancangan Acak Lengkap (RAL) faktorial dengan 3 ulangan. Faktor pertama, konsentrasi

Lebih terperinci

HASIL DAN PEMBAHASAN. Transformasi ke dalam Agrobacterium

HASIL DAN PEMBAHASAN. Transformasi ke dalam Agrobacterium Konfirmasi Koloni Transforman dengan Teknik PCR Koloni Koloni bakteri yang tumbuh setelah transformasi dianalisis dengan metode PCR koloni. Koloni yang tumbuh pada media LA diambil dengan menggunakan tusuk

Lebih terperinci

II. BAHAN DAN METODE

II. BAHAN DAN METODE II. BAHAN DAN METODE 2.1. Waktu dan Lokasi Penelitian Penelitian ini dilaksanakan dari bulan Agustus sampai September tahun 2011. Sampel ikan berasal dari 3 lokasi yaitu Jawa (Jawa Barat), Sumatera (Jambi),

Lebih terperinci

III. BAHAN DAN METODE. Penelitian ini dilaksanakan di Laboratorium Ilmu Tanaman, Jurusan

III. BAHAN DAN METODE. Penelitian ini dilaksanakan di Laboratorium Ilmu Tanaman, Jurusan 22 III. BAHAN DAN METODE 3.1 Tempat dan Waktu Penelitian Penelitian ini dilaksanakan di Laboratorium Ilmu Tanaman, Jurusan Agroteknologi, Fakultas Pertanian, Universitas Lampung, Bandar Lampung. Penelitian

Lebih terperinci

LAPORAN PRAKTIKUM REKAYASA GENETIKA

LAPORAN PRAKTIKUM REKAYASA GENETIKA LAPORAN PRAKTIKUM REKAYASA GENETIKA LAPORAN IV (ISOLASI RNA DARI TANAMAN) KHAIRUL ANAM P051090031/BTK BIOTEKNOLOGI SEKOLAH PASCASARJANA INSTITUT PERTANIAN BOGOR 2010 0 ISOLASI RNA DARI TANAMAN TUJUAN Tujuan

Lebih terperinci

BAHAN DAN METODE Tempat dan Waktu Penelitian Metode Penelitian Pengambilan Sampel Tanaman Nilam Bergejala Mosaik di Lapangan Deteksi Potyvirus

BAHAN DAN METODE Tempat dan Waktu Penelitian Metode Penelitian Pengambilan Sampel Tanaman Nilam Bergejala Mosaik di Lapangan Deteksi Potyvirus BAHAN DAN METODE Tempat dan Waktu Penelitian Survei penyakit mosaik dan koleksi sampel tanaman nilam sakit dilakukan di Kebun Percobaan Balai Tanaman Obat dan Aromatik (BALITTRO) di daerah Gunung Bunder

Lebih terperinci

BAB III. METODE PENELITIAN. Penelitian dilaksanakan di Laboratorium Kultur In-Vitro Universitas

BAB III. METODE PENELITIAN. Penelitian dilaksanakan di Laboratorium Kultur In-Vitro Universitas BAB III. METODE PENELITIAN 3.1. Waktu dan Tempat Penelitian dilaksanakan di Laboratorium Kultur In-Vitro Universitas Muhammadiyah Malang. Penelitian dilakukan selama ± 4 bulan, mulai dari bulan Januari

Lebih terperinci

III. BAHAN DAN METODE. Penelitian dilakukan di Laboratorium Kultur Jaringan / Ilmu Tanaman Fakultas

III. BAHAN DAN METODE. Penelitian dilakukan di Laboratorium Kultur Jaringan / Ilmu Tanaman Fakultas III. BAHAN DAN METODE 3.1 Tempat dan Waktu Penelitian Penelitian dilakukan di Laboratorium Kultur Jaringan / Ilmu Tanaman Fakultas Pertanian Universitas Lampung. Penelitian dilaksanakan mulai Maret 2013

Lebih terperinci

Kultur jaringan tanaman (Picture from

Kultur jaringan tanaman (Picture from http://rohmatchemistry.staff.ipb.ac.id/2018/06/08/prosedur-penggunaan-plant-preservative-mixture -ppm-pada-media-kultur-jaringan-untuk-peningkatan-kualitas-dan-kuantitas-tanaman-kultur-jaringa n/ Prosedur

Lebih terperinci

Pengaruh Retardan dan Aspirin dalam Menginduksi Pembentukan Umbi Mikro Kentang (Solanum tuberosum) Secara In Vitro

Pengaruh Retardan dan Aspirin dalam Menginduksi Pembentukan Umbi Mikro Kentang (Solanum tuberosum) Secara In Vitro Pengaruh Retardan dan Aspirin dalam Menginduksi Pembentukan Umbi Mikro Kentang (Solanum tuberosum) Secara In Vitro Endah Wahyurini, SP MSi Jurusan Agronomi, Fakultas Pertanian Universitas Pembangunan Nasional

Lebih terperinci

PRAKTIKUM ISOLASI DNA DAN TEKNIK PCR

PRAKTIKUM ISOLASI DNA DAN TEKNIK PCR PRAKTIKUM ISOLASI DNA DAN TEKNIK PCR Tujuan: i) Mengerti metode umum mengisolasi DNA ii) Mengisolasi DNA dari buah dan sel-sel epithelial mulut iii) Mengerti dan mempraktek teknik PCR dengan sempel DNA

Lebih terperinci

BAHAN DAN METODE Waktu dan Tempat Penelitian Bahan dan Alat

BAHAN DAN METODE Waktu dan Tempat Penelitian Bahan dan Alat BAHAN DAN METODE Waktu dan Tempat Penelitian Penelitian dilaksanakan mulai bulan Januari 2009 sampai dengan bulan Agustus 2009 di Laboratorium Bioteknologi Tanaman, Departemen Agronomi dan Hortikultura,

Lebih terperinci

METODOLOGI PENELITIAN. Tempat dan Waktu Penelitian. Bahan dan Alat Penelitian

METODOLOGI PENELITIAN. Tempat dan Waktu Penelitian. Bahan dan Alat Penelitian 14 METODOLOGI PENELITIAN Tempat dan Waktu Penelitian Tempat penelitian dilakukan di Laboratorium Unit Pelayanan Mikrobiologi Terpadu, Bagian Mikrobiologi Kesehatan, Departemen Ilmu Penyakit Hewan dan Kesehatan

Lebih terperinci

BAB III METODOLOGI PENELITIAN. Penelitian dilaksanakan mulai bulan Juli sampai bulan November 2009

BAB III METODOLOGI PENELITIAN. Penelitian dilaksanakan mulai bulan Juli sampai bulan November 2009 BAB III METODOLOGI PENELITIAN 3.1 Waktu dan Lokasi Penelitian Penelitian dilaksanakan mulai bulan Juli sampai bulan November 2009 yang bertempat di Laboratorium Riset, Jurusan Pendidikan Kimia, Fakultas

Lebih terperinci

TUGAS TERSTRUKTUR BIOTEKNOLOGI PERTANIAN VEKTOR DNA

TUGAS TERSTRUKTUR BIOTEKNOLOGI PERTANIAN VEKTOR DNA TUGAS TERSTRUKTUR BIOTEKNOLOGI PERTANIAN VEKTOR DNA Oleh: Gregorius Widodo Adhi Prasetyo A2A015009 KEMENTERIAN RISET TEKNOLOGI DAN PENDIDIKAN TINGGI UNIVERSITAS JENDERAL SOEDIRMAN FAKULTAS PERTANIAN PROGRAM

Lebih terperinci

BAHAN DAN METODE Tempat dan Waktu Bahan Peremajaan Aktinomiset dari Kultur Penyimpanan Perbanyakan Sclerotium rolfsii dari Kultur Penyimpanan

BAHAN DAN METODE Tempat dan Waktu Bahan Peremajaan Aktinomiset dari Kultur Penyimpanan Perbanyakan Sclerotium rolfsii dari Kultur Penyimpanan BAHAN DAN METODE Tempat dan Waktu Penelitian dilaksanakan di Laboratorium Bakteriologi Tumbuhan, Departemen Proteksi Tanaman, Fakultas Pertanian, Institut Pertanian Bogor (IPB) mulai Maret 2011 sampai

Lebih terperinci

4 Hasil dan Pembahasan

4 Hasil dan Pembahasan 4 Hasil dan Pembahasan α-amilase adalah enzim menghidrolisis ikatan α-1,4-glikosidik pada pati. α-amilase disekresikan oleh mikroorganisme, tanaman, dan organisme tingkat tinggi. α-amilase memiliki peranan

Lebih terperinci

MATERI DAN METODE. Kota Padang Sumatera Barat pada bulan Oktober Amplifikasi gen Growth

MATERI DAN METODE. Kota Padang Sumatera Barat pada bulan Oktober Amplifikasi gen Growth III. MATERI DAN METODE 3.1 Waktu dan Tempat Pengambilan sampel darah domba dilakukan di Kecamatan Koto Tengah Kota Padang Sumatera Barat pada bulan Oktober 2012. Amplifikasi gen Growth Hormone menggunakan

Lebih terperinci

bio.unsoed.ac.id METODE PENELITIAN A. Materi, Lokasi, dan Waktu Penelitian 1. Materi Penelitian

bio.unsoed.ac.id METODE PENELITIAN A. Materi, Lokasi, dan Waktu Penelitian 1. Materi Penelitian III. METODE PENELITIAN A. Materi, Lokasi, dan Waktu Penelitian 1. Materi Penelitian 1.1. Peralatan Penelitian Alat yang digunakan dalam penelitian ini adalah botol sampel, beaker glass, cool box, labu

Lebih terperinci

III. TATA CARA PENELITIAN. A. Tempat dan Waktu Penelitian. Penelitian ini dilaksanakan di Laboratorium Kultur In vitro Fakultas

III. TATA CARA PENELITIAN. A. Tempat dan Waktu Penelitian. Penelitian ini dilaksanakan di Laboratorium Kultur In vitro Fakultas III. TATA CARA PENELITIAN A. Tempat dan Waktu Penelitian Penelitian ini dilaksanakan di Laboratorium Kultur In vitro Fakultas Pertanian Universitas Muhammadiyah Yogyakarta, pada Bulan November 2015 hingga

Lebih terperinci

III. METODE PENELITIAN. Penelitian ini dilakukan di Laboratorium Mikrobiologi Jurusan Biologi

III. METODE PENELITIAN. Penelitian ini dilakukan di Laboratorium Mikrobiologi Jurusan Biologi 17 III. METODE PENELITIAN A. Tempat dan Waktu Penelitian Penelitian ini dilakukan di Laboratorium Mikrobiologi Jurusan Biologi Fakultas Matematika dan Ilmu Pengetahuan Alam Universitas Lampung pada Januari

Lebih terperinci

TATA CARA PENELITIAN. A. Waktu dan Tempat Penelitian. Penelitian dilaksanakan di Laboratorium Kultur In Vitro Fakultas

TATA CARA PENELITIAN. A. Waktu dan Tempat Penelitian. Penelitian dilaksanakan di Laboratorium Kultur In Vitro Fakultas III. TATA CARA PENELITIAN A. Waktu dan Tempat Penelitian Penelitian dilaksanakan di Laboratorium Kultur In Vitro Fakultas Pertanian Universitas Muhammadiyah Yogyakarta. Penelitian dimulai pada bulan April

Lebih terperinci

Deskripsi. PROSES INDUKSI KALUS TANAMAN TEBU (Saccharum officinarum L.) SECARA KULTUR JARINGAN

Deskripsi. PROSES INDUKSI KALUS TANAMAN TEBU (Saccharum officinarum L.) SECARA KULTUR JARINGAN 1 Deskripsi PROSES INDUKSI KALUS TANAMAN TEBU (Saccharum officinarum L.) SECARA KULTUR JARINGAN Bidang Teknik Invensi Invensi ini secara umum berhubungan dengan proses induksi kalus tanaman tebu secara

Lebih terperinci